EMAIL THIS PAGE TO A FRIEND

CAAP1

caspase activity and apoptosis inhibitor 1

100 Gene Product Result for
Synonyms: C9orf82 CAAP RP11-337A23.1
UniProtKB ID: Q9H8G2, B4DWT4, D3DRK4, Q5VY32, Q6IPE6, Q96C59
Gene ID:
Mouse(67770) caspase activity and apoptosis inhibitor 1
Rat(500501) caspase activity and apoptosis inhibitor 1
naked mole-rat(101707768) caspase activity and apoptosis inhibitor 1
domestic guinea pig(100728936) caspase activity and apoptosis inhibitor 1
sheep(101109512) caspase activity and apoptosis inhibitor 1
dog(474732) caspase activity and apoptosis inhibitor 1
cow(515858) chromosome 8 open reading frame, human C9orf82
domestic cat(101091484) caspase activity and apoptosis inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024828 Rosetta Predictions human pricing
NM_001034154 Rosetta Predictions rat pricing
NM_026368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184271 predicted 802
2 SASI_Hs01_00184272 predicted 861
3 SASI_Hs01_00184273 predicted 1049
4 SASI_Hs01_00184274 predicted 631
5 SASI_Hs01_00184275 predicted 758
6 SASI_Hs01_00184276 predicted 1087
7 SASI_Hs01_00184277 predicted 655
8 SASI_Hs01_00184278 predicted 502
9 SASI_Hs01_00184279 predicted 31
10 SASI_Hs01_00184280 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044087 predicted 612
2 SASI_Rn01_00044088 predicted 710
3 SASI_Rn01_00044089 predicted 832
4 SASI_Rn01_00044090 predicted 604
5 SASI_Rn01_00044091 predicted 817
6 SASI_Rn01_00044092 predicted 591
7 SASI_Rn01_00044093 predicted 855
8 SASI_Rn02_00204013 predicted 721
9 SASI_Rn01_00044095 predicted 794
10 SASI_Rn01_00044096 predicted 599
11 SASI_Rn01_00044094 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167911 predicted 514
2 SASI_Mm01_00167912 predicted 480
3 SASI_Mm01_00167913 predicted 601
4 SASI_Mm01_00167914 predicted 465
5 SASI_Mm01_00167915 predicted 456
6 SASI_Mm01_00167916 predicted 604
7 SASI_Mm01_00167917 predicted 466
8 SASI_Mm01_00167918 predicted 460
9 SASI_Mm01_00167919 predicted 513
10 SASI_Mm01_00167920 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026368
VALIDATED
CAAP1 MISSION shRNA Bacterial Glycerol Stock
caspase activity and apoptosis inhibitor 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026368.1-798s21c1
Sequence:CCGGGATGCTTATGACAGCGATATACTCGAGTATATCGCTGTCATAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-1073s1c1
Sequence:CCGGGGAGCTTCTAGAACTTGAAATCTCGAGATTTCAAGTTCTAGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-1105s1c1
Sequence:CCGGCAATTAAGGCTCTCATGAAAGCTCGAGCTTTCATGAGAGCCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-771s1c1
Sequence:CCGGGATAGTGATGTACTCAGTATACTCGAGTATACTGAGTACATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026368.1-1642s21c1
Sequence:CCGGGCGAAACCTAATGAACTGTTTCTCGAGAAACAGTTCATTAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026368.1-1469s21c1
Sequence:CCGGGCTTTAAGAAAGATTGACCAACTCGAGTTGGTCAATCTTTCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026368.1-470s21c1
Sequence:CCGGCTTCTGTATCATAGGAGAGAACTCGAGTTCTCTCCTATGATACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026368.1-1682s1c1
Sequence:CCGGCGAACTTGCTTTAAGAGCTTTCTCGAGAAAGCTCTTAAAGCAAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-798s1c1
Sequence:CCGGGATGCTTATGACAGCGATATACTCGAGTATATCGCTGTCATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-1642s1c1
Sequence:CCGGGCGAAACCTAATGAACTGTTTCTCGAGAAACAGTTCATTAGGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-1469s1c1
Sequence:CCGGGCTTTAAGAAAGATTGACCAACTCGAGTTGGTCAATCTTTCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-317s1c1
Sequence:CCGGGCAGCAGGAAACCAAGTATCTCTCGAGAGATACTTGGTTTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-795s1c1
Sequence:CCGGGCAGATGCTTATGACAGCGATCTCGAGATCGCTGTCATAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-470s1c1
Sequence:CCGGCTTCTGTATCATAGGAGAGAACTCGAGTTCTCTCCTATGATACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026368
VALIDATED
CAAP1 MISSION shRNA shRNA Plasmid DNA
caspase activity and apoptosis inhibitor 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026368.1-798s21c1
Sequence:CCGGGATGCTTATGACAGCGATATACTCGAGTATATCGCTGTCATAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-1073s1c1
Sequence:CCGGGGAGCTTCTAGAACTTGAAATCTCGAGATTTCAAGTTCTAGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-1105s1c1
Sequence:CCGGCAATTAAGGCTCTCATGAAAGCTCGAGCTTTCATGAGAGCCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-771s1c1
Sequence:CCGGGATAGTGATGTACTCAGTATACTCGAGTATACTGAGTACATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026368.1-1642s21c1
Sequence:CCGGGCGAAACCTAATGAACTGTTTCTCGAGAAACAGTTCATTAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026368.1-1469s21c1
Sequence:CCGGGCTTTAAGAAAGATTGACCAACTCGAGTTGGTCAATCTTTCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026368.1-470s21c1
Sequence:CCGGCTTCTGTATCATAGGAGAGAACTCGAGTTCTCTCCTATGATACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026368.1-1682s1c1
Sequence:CCGGCGAACTTGCTTTAAGAGCTTTCTCGAGAAAGCTCTTAAAGCAAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-798s1c1
Sequence:CCGGGATGCTTATGACAGCGATATACTCGAGTATATCGCTGTCATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-1642s1c1
Sequence:CCGGGCGAAACCTAATGAACTGTTTCTCGAGAAACAGTTCATTAGGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-1469s1c1
Sequence:CCGGGCTTTAAGAAAGATTGACCAACTCGAGTTGGTCAATCTTTCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-317s1c1
Sequence:CCGGGCAGCAGGAAACCAAGTATCTCTCGAGAGATACTTGGTTTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-795s1c1
Sequence:CCGGGCAGATGCTTATGACAGCGATCTCGAGATCGCTGTCATAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-470s1c1
Sequence:CCGGCTTCTGTATCATAGGAGAGAACTCGAGTTCTCTCCTATGATACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026368
VALIDATED
CAAP1 MISSION shRNA Lentiviral Transduction Particles
caspase activity and apoptosis inhibitor 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026368.1-798s21c1
Sequence:CCGGGATGCTTATGACAGCGATATACTCGAGTATATCGCTGTCATAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-1073s1c1
Sequence:CCGGGGAGCTTCTAGAACTTGAAATCTCGAGATTTCAAGTTCTAGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-1105s1c1
Sequence:CCGGCAATTAAGGCTCTCATGAAAGCTCGAGCTTTCATGAGAGCCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-771s1c1
Sequence:CCGGGATAGTGATGTACTCAGTATACTCGAGTATACTGAGTACATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026368.1-1642s21c1
Sequence:CCGGGCGAAACCTAATGAACTGTTTCTCGAGAAACAGTTCATTAGGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026368.1-1469s21c1
Sequence:CCGGGCTTTAAGAAAGATTGACCAACTCGAGTTGGTCAATCTTTCTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026368.1-470s21c1
Sequence:CCGGCTTCTGTATCATAGGAGAGAACTCGAGTTCTCTCCTATGATACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026368.1-1682s1c1
Sequence:CCGGCGAACTTGCTTTAAGAGCTTTCTCGAGAAAGCTCTTAAAGCAAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-798s1c1
Sequence:CCGGGATGCTTATGACAGCGATATACTCGAGTATATCGCTGTCATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-1642s1c1
Sequence:CCGGGCGAAACCTAATGAACTGTTTCTCGAGAAACAGTTCATTAGGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-1469s1c1
Sequence:CCGGGCTTTAAGAAAGATTGACCAACTCGAGTTGGTCAATCTTTCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026368.1-317s1c1
Sequence:CCGGGCAGCAGGAAACCAAGTATCTCTCGAGAGATACTTGGTTTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-795s1c1
Sequence:CCGGGCAGATGCTTATGACAGCGATCTCGAGATCGCTGTCATAAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026368.1-470s1c1
Sequence:CCGGCTTCTGTATCATAGGAGAGAACTCGAGTTCTCTCCTATGATACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024828
VALIDATED
CAAP1 MISSION shRNA Bacterial Glycerol Stock
caspase activity and apoptosis inhibitor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-1064s21c1
Sequence:CCGGTAATGAAAGCTGGTGATATAACTCGAGTTATATCACCAGCTTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-765s21c1
Sequence:CCGGTAGTGATGTACTCAGTATAAACTCGAGTTTATACTGAGTACATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_024828.2-1039s21c1
Sequence:CCGGATGAGGGCAAGAGCGATTAAACTCGAGTTTAATCGCTCTTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024828.2-1715s21c1
Sequence:CCGGACGCCATTCTAACAGGTATTTCTCGAGAAATACCTGTTAGAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-791s21c1
Sequence:CCGGATGCTTATGACAGCGACATAGCTCGAGCTATGTCGCTGTCATAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024828.1-838s1c1
Sequence:CCGGGATAGTGATGTACTCAGTATACTCGAGTATACTGAGTACATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024828
VALIDATED
CAAP1 MISSION shRNA shRNA Plasmid DNA
caspase activity and apoptosis inhibitor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-1064s21c1
Sequence:CCGGTAATGAAAGCTGGTGATATAACTCGAGTTATATCACCAGCTTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-765s21c1
Sequence:CCGGTAGTGATGTACTCAGTATAAACTCGAGTTTATACTGAGTACATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_024828.2-1039s21c1
Sequence:CCGGATGAGGGCAAGAGCGATTAAACTCGAGTTTAATCGCTCTTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024828.2-1715s21c1
Sequence:CCGGACGCCATTCTAACAGGTATTTCTCGAGAAATACCTGTTAGAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-791s21c1
Sequence:CCGGATGCTTATGACAGCGACATAGCTCGAGCTATGTCGCTGTCATAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024828.1-838s1c1
Sequence:CCGGGATAGTGATGTACTCAGTATACTCGAGTATACTGAGTACATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024828
VALIDATED
CAAP1 MISSION shRNA Lentiviral Transduction Particles
caspase activity and apoptosis inhibitor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-1064s21c1
Sequence:CCGGTAATGAAAGCTGGTGATATAACTCGAGTTATATCACCAGCTTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-765s21c1
Sequence:CCGGTAGTGATGTACTCAGTATAAACTCGAGTTTATACTGAGTACATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_024828.2-1039s21c1
Sequence:CCGGATGAGGGCAAGAGCGATTAAACTCGAGTTTAATCGCTCTTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_024828.2-1715s21c1
Sequence:CCGGACGCCATTCTAACAGGTATTTCTCGAGAAATACCTGTTAGAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024828.2-791s21c1
Sequence:CCGGATGCTTATGACAGCGACATAGCTCGAGCTATGTCGCTGTCATAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024828.1-838s1c1
Sequence:CCGGGATAGTGATGTACTCAGTATACTCGAGTATACTGAGTACATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks