EMAIL THIS PAGE TO A FRIEND

CAB39

calcium binding protein 39

Synonyms: MO25
UniProtKB ID: Q9Y376
Gene ID:
Mouse(12283) calcium binding protein 39
Rat(301574) calcium binding protein 39
sheep(101106309) calcium binding protein 39
Domestic Rabbit(100342118) calcium binding protein 39
naked mole-rat(101696725) calcium binding protein 39
domestic guinea pig(100713955) calcium binding protein 39
Zebrafish(415235) calcium binding protein 39
Horse(100063745) calcium binding protein 39
cow(511451) calcium binding protein 39
domestic cat(101090379) calcium binding protein 39
dog(477403) calcium binding protein 39
chicken(424830) calcium binding protein 39
205 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016289 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016289 Rosetta Predictions human pricing
NM_001106924 Rosetta Predictions rat pricing
NM_133781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168970 predicted 473
2 SASI_Hs01_00168971 predicted 1375
3 SASI_Hs01_00168972 predicted 729
4 SASI_Hs01_00168973 predicted 1412
5 SASI_Hs01_00168975 predicted 504
6 SASI_Hs01_00168976 predicted 434
7 SASI_Hs01_00168977 predicted 856
8 SASI_Hs02_00349211 predicted 1341
9 SASI_Hs01_00168978 predicted 1073
10 SASI_Hs02_00349212 predicted 650
11 SASI_Hs01_00168974 predicted 1231
12 SASI_Hs01_00168979 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223746 predicted 976
2 SASI_Rn02_00223747 predicted 991
3 SASI_Rn02_00223748 predicted 1043
4 SASI_Rn02_00223749 predicted 748
5 SASI_Rn02_00223750 predicted 801
6 SASI_Rn02_00223751 predicted 1171
7 SASI_Rn02_00223752 predicted 826
8 SASI_Rn02_00223753 predicted 1033
9 SASI_Rn02_00223754 predicted 828
10 SASI_Rn02_00223755 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045033 predicted 726
2 SASI_Mm01_00045034 predicted 926
3 SASI_Mm02_00338804 predicted 825
4 SASI_Mm02_00338805 predicted 1137
5 SASI_Mm01_00045036 predicted 944
6 SASI_Mm02_00338806 predicted 829
7 SASI_Mm01_00045038 predicted 533
8 SASI_Mm02_00338807 predicted 851
9 SASI_Mm01_00045039 predicted 959
10 SASI_Mm02_00338808 predicted 744
11 SASI_Mm01_00045035 predicted 605
12 SASI_Mm01_00045037 predicted 661
13 SASI_Mm01_00045040 predicted 688
14 SASI_Mm01_00045041 predicted 314
15 SASI_Mm01_00045042 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133781
VALIDATED
CAB39 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 39
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133781.2-2111s1c1
Sequence:CCGGCCCTGTATTCAGTTACCCAATCTCGAGATTGGGTAACTGAATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133781.2-190s1c1
Sequence:CCGGCGGCAGATATTGTGAAGAACTCTCGAGAGTTCTTCACAATATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133781.2-309s1c1
Sequence:CCGGGAAATTCTGTACGGCACCAATCTCGAGATTGGTGCCGTACAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133781.2-706s1c1
Sequence:CCGGCATTTGCTACATTCAAGGATTCTCGAGAATCCTTGAATGTAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133781.2-711s1c1
Sequence:CCGGGCTACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1174s21c1
Sequence:CCGGGCCTGAGAACCTCAAGCTAATCTCGAGATTAGCTTGAGGTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-777s21c1
Sequence:CCGGTCTGCACCCAACAGAATATTTCTCGAGAAATATTCTGTTGGGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1531s21c1
Sequence:CCGGCTACTGCTAATCTGCTGTTAACTCGAGTTAACAGCAGATTAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-836s21c1
Sequence:CCGGGCTCTTAATTGTGGGATAATGCTCGAGCATTATCCCACAATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-444s21c1
Sequence:CCGGACAAGTCTCCGGCAGATATTGCTCGAGCAATATCTGCCGGAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1377s21c1
Sequence:CCGGACGACGAGAAGACCTACTTAGCTCGAGCTAAGTAGGTCTTCTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133781
VALIDATED
CAB39 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 39
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133781.2-2111s1c1
Sequence:CCGGCCCTGTATTCAGTTACCCAATCTCGAGATTGGGTAACTGAATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133781.2-190s1c1
Sequence:CCGGCGGCAGATATTGTGAAGAACTCTCGAGAGTTCTTCACAATATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133781.2-309s1c1
Sequence:CCGGGAAATTCTGTACGGCACCAATCTCGAGATTGGTGCCGTACAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133781.2-706s1c1
Sequence:CCGGCATTTGCTACATTCAAGGATTCTCGAGAATCCTTGAATGTAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133781.2-711s1c1
Sequence:CCGGGCTACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1174s21c1
Sequence:CCGGGCCTGAGAACCTCAAGCTAATCTCGAGATTAGCTTGAGGTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-777s21c1
Sequence:CCGGTCTGCACCCAACAGAATATTTCTCGAGAAATATTCTGTTGGGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1531s21c1
Sequence:CCGGCTACTGCTAATCTGCTGTTAACTCGAGTTAACAGCAGATTAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-836s21c1
Sequence:CCGGGCTCTTAATTGTGGGATAATGCTCGAGCATTATCCCACAATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-444s21c1
Sequence:CCGGACAAGTCTCCGGCAGATATTGCTCGAGCAATATCTGCCGGAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1377s21c1
Sequence:CCGGACGACGAGAAGACCTACTTAGCTCGAGCTAAGTAGGTCTTCTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133781
VALIDATED
CAB39 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 39
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133781.2-2111s1c1
Sequence:CCGGCCCTGTATTCAGTTACCCAATCTCGAGATTGGGTAACTGAATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133781.2-190s1c1
Sequence:CCGGCGGCAGATATTGTGAAGAACTCTCGAGAGTTCTTCACAATATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133781.2-309s1c1
Sequence:CCGGGAAATTCTGTACGGCACCAATCTCGAGATTGGTGCCGTACAGAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133781.2-706s1c1
Sequence:CCGGCATTTGCTACATTCAAGGATTCTCGAGAATCCTTGAATGTAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133781.2-711s1c1
Sequence:CCGGGCTACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1174s21c1
Sequence:CCGGGCCTGAGAACCTCAAGCTAATCTCGAGATTAGCTTGAGGTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-777s21c1
Sequence:CCGGTCTGCACCCAACAGAATATTTCTCGAGAAATATTCTGTTGGGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1531s21c1
Sequence:CCGGCTACTGCTAATCTGCTGTTAACTCGAGTTAACAGCAGATTAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-836s21c1
Sequence:CCGGGCTCTTAATTGTGGGATAATGCTCGAGCATTATCCCACAATTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-444s21c1
Sequence:CCGGACAAGTCTCCGGCAGATATTGCTCGAGCAATATCTGCCGGAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133781.4-1377s21c1
Sequence:CCGGACGACGAGAAGACCTACTTAGCTCGAGCTAAGTAGGTCTTCTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016289
VALIDATED
CAB39 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 39
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-880s1c1
Sequence:CCGGGCCACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-439s1c1
Sequence:CCGGGCTACAGAAGAAGTTTCCAAACTCGAGTTTGGAAACTTCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-1287s1c1
Sequence:CCGGCGAGAAGACCTATTTAGTTAACTCGAGTTAACTAAATAGGTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-659s1c1
Sequence:CCGGCGAGAACTCCTACTGTTGAATCTCGAGATTCAACAGTAGGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-967s1c1
Sequence:CCGGGAGAAGTTACTTCATTCAGAACTCGAGTTCTGAATGAAGTAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-1395s21c1
Sequence:CCGGCGAGAAGACCTATTTAGTTAACTCGAGTTAACTAAATAGGTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-767s21c1
Sequence:CCGGCGAGAACTCCTACTGTTGAATCTCGAGATTCAACAGTAGGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-988s21c1
Sequence:CCGGGCCACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-547s21c1
Sequence:CCGGGCTACAGAAGAAGTTTCCAAACTCGAGTTTGGAAACTTCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-1075s21c1
Sequence:CCGGGAGAAGTTACTTCATTCAGAACTCGAGTTCTGAATGAAGTAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016289
VALIDATED
CAB39 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 39
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-880s1c1
Sequence:CCGGGCCACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-439s1c1
Sequence:CCGGGCTACAGAAGAAGTTTCCAAACTCGAGTTTGGAAACTTCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-1287s1c1
Sequence:CCGGCGAGAAGACCTATTTAGTTAACTCGAGTTAACTAAATAGGTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-659s1c1
Sequence:CCGGCGAGAACTCCTACTGTTGAATCTCGAGATTCAACAGTAGGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-967s1c1
Sequence:CCGGGAGAAGTTACTTCATTCAGAACTCGAGTTCTGAATGAAGTAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-1395s21c1
Sequence:CCGGCGAGAAGACCTATTTAGTTAACTCGAGTTAACTAAATAGGTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-767s21c1
Sequence:CCGGCGAGAACTCCTACTGTTGAATCTCGAGATTCAACAGTAGGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-988s21c1
Sequence:CCGGGCCACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-547s21c1
Sequence:CCGGGCTACAGAAGAAGTTTCCAAACTCGAGTTTGGAAACTTCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-1075s21c1
Sequence:CCGGGAGAAGTTACTTCATTCAGAACTCGAGTTCTGAATGAAGTAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016289
VALIDATED
CAB39 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 39
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-880s1c1
Sequence:CCGGGCCACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-439s1c1
Sequence:CCGGGCTACAGAAGAAGTTTCCAAACTCGAGTTTGGAAACTTCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-1287s1c1
Sequence:CCGGCGAGAAGACCTATTTAGTTAACTCGAGTTAACTAAATAGGTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-659s1c1
Sequence:CCGGCGAGAACTCCTACTGTTGAATCTCGAGATTCAACAGTAGGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016289.2-967s1c1
Sequence:CCGGGAGAAGTTACTTCATTCAGAACTCGAGTTCTGAATGAAGTAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-1395s21c1
Sequence:CCGGCGAGAAGACCTATTTAGTTAACTCGAGTTAACTAAATAGGTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-767s21c1
Sequence:CCGGCGAGAACTCCTACTGTTGAATCTCGAGATTCAACAGTAGGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-988s21c1
Sequence:CCGGGCCACATTCAAGGATTTACTTCTCGAGAAGTAAATCCTTGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-547s21c1
Sequence:CCGGGCTACAGAAGAAGTTTCCAAACTCGAGTTTGGAAACTTCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016289.3-1075s21c1
Sequence:CCGGGAGAAGTTACTTCATTCAGAACTCGAGTTCTGAATGAAGTAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks