EMAIL THIS PAGE TO A FRIEND

CAB39L

calcium binding protein 39-like

Synonyms: MO25-BETA MO2L bA103J18.3
UniProtKB ID: Q9H9S4, Q5TAW6, Q6WG71, Q96FG1, Q9BZ33
Gene ID:
Mouse(69008) calcium binding protein 39-like
Rat(290291) calcium binding protein 39-like
Zebrafish(492361) calcium binding protein 39-like
cow(519724) calcium binding protein 39-like
Horse(100050219) calcium binding protein 39-like
domestic cat(101094151) calcium binding protein 39-like
dog(485442) calcium binding protein 39-like
chicken(418865) calcium binding protein 39-like
domestic guinea pig(100719727) calcium binding protein 39-like
naked mole-rat(101725880) calcium binding protein 39-like
sheep(101115803) calcium binding protein 39-like
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031724 Rosetta Predictions human pricing
NM_001079670 Rosetta Predictions human pricing
NM_030925 Rosetta Predictions human pricing
NM_001011917 Rosetta Predictions rat pricing
XM_573796 Rosetta Predictions rat pricing
NM_026908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235376 predicted 939
2 SASI_Hs01_00235377 predicted 1125
3 SASI_Hs01_00235378 predicted 1160
4 SASI_Hs01_00235379 predicted 1129
5 SASI_Hs01_00235380 predicted 1034
6 SASI_Hs01_00235381 predicted 1067
7 SASI_Hs01_00235382 predicted 1073
8 SASI_Hs01_00235383 predicted 1215
9 SASI_Hs01_00235384 predicted 1037
10 SASI_Hs01_00235385 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313640 predicted 1437
2 SASI_Hs02_00313641 predicted 691
3 SASI_Hs02_00313642 predicted 902
4 SASI_Hs02_00313643 predicted 626
5 SASI_Hs02_00313644 predicted 1384
6 SASI_Hs02_00313645 predicted 885
7 SASI_Hs02_00313646 predicted 828
8 SASI_Hs02_00313647 predicted 708
9 SASI_Hs02_00313648 predicted 598
10 SASI_Hs02_00313649 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358479 predicted 1593
2 SASI_Hs02_00358480 predicted 845
3 SASI_Hs02_00358481 predicted 1056
4 SASI_Hs02_00358482 predicted 774
5 SASI_Hs02_00358483 predicted 1545
6 SASI_Hs02_00358484 predicted 1038
7 SASI_Hs02_00358485 predicted 974
8 SASI_Hs02_00358486 predicted 865
9 SASI_Hs02_00358487 predicted 756
10 SASI_Hs01_00083392 predicted 1298
11 SASI_Hs01_00083385 predicted 653
12 SASI_Hs01_00083386 predicted 844
13 SASI_Hs01_00083387 predicted 874
14 SASI_Hs01_00083388 predicted 853
15 SASI_Hs01_00083389 predicted 763
16 SASI_Hs01_00083390 predicted 944
17 SASI_Hs01_00083391 predicted 788
18 SASI_Hs01_00083393 predicted 926
19 SASI_Hs01_00083394 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199914 predicted 798
2 SASI_Rn01_00044297 predicted 1113
3 SASI_Rn01_00044298 predicted 488
4 SASI_Rn02_00199915 predicted 546
5 SASI_Rn01_00044300 predicted 598
6 SASI_Rn01_00044301 predicted 674
7 SASI_Rn01_00044302 predicted 723
8 SASI_Rn01_00044304 predicted 518
9 SASI_Rn01_00044305 predicted 735
10 SASI_Rn01_00044306 predicted 744
11 SASI_Rn01_00044299 predicted 1100
12 SASI_Rn01_00044303 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139673 predicted 1463
2 SASI_Rn01_00139674 predicted 827
3 SASI_Rn01_00139675 predicted 1444
4 SASI_Rn01_00139676 predicted 951
5 SASI_Rn01_00139677 predicted 1025
6 SASI_Rn01_00139678 predicted 1060
7 SASI_Rn01_00139679 predicted 1075
8 SASI_Rn01_00139680 predicted 865
9 SASI_Rn01_00139681 predicted 1074
10 SASI_Rn01_00139682 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089286 predicted 706
2 SASI_Mm01_00089287 predicted 946
3 SASI_Mm01_00089288 predicted 595
4 SASI_Mm01_00089289 predicted 761
5 SASI_Mm01_00089290 predicted 1240
6 SASI_Mm01_00089292 predicted 643
7 SASI_Mm01_00089293 predicted 430
8 SASI_Mm01_00089294 predicted 1004
9 SASI_Mm02_00331180 predicted 779
10 SASI_Mm01_00089295 predicted 851
11 SASI_Mm01_00089291 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030925
CAB39L MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 39-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030925.2-1009s21c1
Sequence:CCGGTACGTGGAGTTGTCAACATTTCTCGAGAAATGTTGACAACTCCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030925.2-1273s21c1
Sequence:CCGGATGAACCTCCTTCGGGATAAACTCGAGTTTATCCCGAAGGAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030925.2-1599s21c1
Sequence:CCGGAGACTTTGGAGGTGCCTATTTCTCGAGAAATAGGCACCTCCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-874s1c1
Sequence:CCGGCAGCCCAAACTCATTGAGTTTCTCGAGAAACTCAATGAGTTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-530s1c1
Sequence:CCGGCCTTTGCTACTTTCAAGGATTCTCGAGAATCCTTGAAAGTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-243s1c1
Sequence:CCGGGCTGATAGACTTTGAGGGAAACTCGAGTTTCCCTCAAAGTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-940s1c1
Sequence:CCGGGACGAGAAGAACTACTTGATTCTCGAGAATCAAGTAGTTCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-328s1c1
Sequence:CCGGGTGGAGTATATTAGTGCTCATCTCGAGATGAGCACTAATATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030925
CAB39L MISSION shRNA shRNA Plasmid DNA
calcium binding protein 39-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030925.2-1009s21c1
Sequence:CCGGTACGTGGAGTTGTCAACATTTCTCGAGAAATGTTGACAACTCCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030925.2-1273s21c1
Sequence:CCGGATGAACCTCCTTCGGGATAAACTCGAGTTTATCCCGAAGGAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030925.2-1599s21c1
Sequence:CCGGAGACTTTGGAGGTGCCTATTTCTCGAGAAATAGGCACCTCCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-874s1c1
Sequence:CCGGCAGCCCAAACTCATTGAGTTTCTCGAGAAACTCAATGAGTTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-530s1c1
Sequence:CCGGCCTTTGCTACTTTCAAGGATTCTCGAGAATCCTTGAAAGTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-243s1c1
Sequence:CCGGGCTGATAGACTTTGAGGGAAACTCGAGTTTCCCTCAAAGTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-940s1c1
Sequence:CCGGGACGAGAAGAACTACTTGATTCTCGAGAATCAAGTAGTTCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-328s1c1
Sequence:CCGGGTGGAGTATATTAGTGCTCATCTCGAGATGAGCACTAATATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030925
CAB39L MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 39-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030925.2-1009s21c1
Sequence:CCGGTACGTGGAGTTGTCAACATTTCTCGAGAAATGTTGACAACTCCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030925.2-1273s21c1
Sequence:CCGGATGAACCTCCTTCGGGATAAACTCGAGTTTATCCCGAAGGAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030925.2-1599s21c1
Sequence:CCGGAGACTTTGGAGGTGCCTATTTCTCGAGAAATAGGCACCTCCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-874s1c1
Sequence:CCGGCAGCCCAAACTCATTGAGTTTCTCGAGAAACTCAATGAGTTTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-530s1c1
Sequence:CCGGCCTTTGCTACTTTCAAGGATTCTCGAGAATCCTTGAAAGTAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-243s1c1
Sequence:CCGGGCTGATAGACTTTGAGGGAAACTCGAGTTTCCCTCAAAGTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-940s1c1
Sequence:CCGGGACGAGAAGAACTACTTGATTCTCGAGAATCAAGTAGTTCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030925.1-328s1c1
Sequence:CCGGGTGGAGTATATTAGTGCTCATCTCGAGATGAGCACTAATATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026908
VALIDATED
CAB39L MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 39-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-1245s21c1
Sequence:CCGGCGAGAAGAACTACCTGATTAACTCGAGTTAATCAGGTAGTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-1011s21c1
Sequence:CCGGCACCATTATGACCAAGTATATCTCGAGATATACTTGGTCATAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-998s21c1
Sequence:CCGGACCGCCACAATTTCACCATTACTCGAGTAATGGTGAAATTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-652s21c1
Sequence:CCGGCCTCACATCCTGTTTATGCTTCTCGAGAAGCATAAACAGGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026908.2-2179s1c1
Sequence:CCGGGCCGACTATCAGTGTCTTCAACTCGAGTTGAAGACACTGATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-1246s1c1
Sequence:CCGGCGAGAAGAACTACCTGATTAACTCGAGTTAATCAGGTAGTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026908.2-653s1c1
Sequence:CCGGCCTCACATCCTGTTTATGCTTCTCGAGAAGCATAAACAGGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-1012s1c1
Sequence:CCGGCACCATTATGACCAAGTATATCTCGAGATATACTTGGTCATAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-999s1c1
Sequence:CCGGACCGCCACAATTTCACCATTACTCGAGTAATGGTGAAATTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026908
VALIDATED
CAB39L MISSION shRNA shRNA Plasmid DNA
calcium binding protein 39-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-1245s21c1
Sequence:CCGGCGAGAAGAACTACCTGATTAACTCGAGTTAATCAGGTAGTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-1011s21c1
Sequence:CCGGCACCATTATGACCAAGTATATCTCGAGATATACTTGGTCATAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-998s21c1
Sequence:CCGGACCGCCACAATTTCACCATTACTCGAGTAATGGTGAAATTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-652s21c1
Sequence:CCGGCCTCACATCCTGTTTATGCTTCTCGAGAAGCATAAACAGGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026908.2-2179s1c1
Sequence:CCGGGCCGACTATCAGTGTCTTCAACTCGAGTTGAAGACACTGATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-1246s1c1
Sequence:CCGGCGAGAAGAACTACCTGATTAACTCGAGTTAATCAGGTAGTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026908.2-653s1c1
Sequence:CCGGCCTCACATCCTGTTTATGCTTCTCGAGAAGCATAAACAGGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-1012s1c1
Sequence:CCGGCACCATTATGACCAAGTATATCTCGAGATATACTTGGTCATAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-999s1c1
Sequence:CCGGACCGCCACAATTTCACCATTACTCGAGTAATGGTGAAATTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026908
VALIDATED
CAB39L MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 39-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-1245s21c1
Sequence:CCGGCGAGAAGAACTACCTGATTAACTCGAGTTAATCAGGTAGTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-1011s21c1
Sequence:CCGGCACCATTATGACCAAGTATATCTCGAGATATACTTGGTCATAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-998s21c1
Sequence:CCGGACCGCCACAATTTCACCATTACTCGAGTAATGGTGAAATTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026908.3-652s21c1
Sequence:CCGGCCTCACATCCTGTTTATGCTTCTCGAGAAGCATAAACAGGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026908.2-2179s1c1
Sequence:CCGGGCCGACTATCAGTGTCTTCAACTCGAGTTGAAGACACTGATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-1246s1c1
Sequence:CCGGCGAGAAGAACTACCTGATTAACTCGAGTTAATCAGGTAGTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026908.2-653s1c1
Sequence:CCGGCCTCACATCCTGTTTATGCTTCTCGAGAAGCATAAACAGGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-1012s1c1
Sequence:CCGGCACCATTATGACCAAGTATATCTCGAGATATACTTGGTCATAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026908.2-999s1c1
Sequence:CCGGACCGCCACAATTTCACCATTACTCGAGTAATGGTGAAATTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks