EMAIL THIS PAGE TO A FRIEND

CABIN1

calcineurin binding protein 1

47 Gene Product Result for
Synonyms: CAIN PPP3IN
UniProtKB ID: Q9Y6J0, Q9Y460
Gene ID:
Human(23523) Summary: Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
Mouse(104248) calcineurin binding protein 1
Rat(94165) calcineurin binding protein 1
Zebrafish(571383) calcineurin binding protein 1
chicken(416938) calcineurin binding protein 1
domestic cat(101082598) calcineurin binding protein 1
cow(530023) calcineurin binding protein 1
dog(486403) calcineurin binding protein 1
sheep(101112167) calcineurin binding protein 1
naked mole-rat(101724270) calcineurin binding protein 1
domestic guinea pig(100717875) calcineurin binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU169161 MISSION® esiRNA esiRNA targeting mouse Cabin1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012295 Rosetta Predictions human pricing
NM_053575 Rosetta Predictions rat pricing
NM_172549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220116 predicted 2585
2 SASI_Hs01_00220117 predicted 488
3 SASI_Hs01_00220118 predicted 1014
4 SASI_Hs02_00344061 predicted 4858
5 SASI_Hs01_00220119 predicted 5026
6 SASI_Hs01_00220121 predicted 368
7 SASI_Hs01_00220122 predicted 2231
8 SASI_Hs01_00220124 predicted 4169
9 SASI_Hs02_00344062 predicted 2302
10 SASI_Hs01_00220125 predicted 3108
11 SASI_Hs01_00220120 predicted 3097
12 SASI_Hs01_00220123 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066087 predicted 5044
2 SASI_Rn01_00066088 predicted 3551
3 SASI_Rn01_00066090 predicted 349
4 SASI_Rn01_00066091 predicted 5049
5 SASI_Rn01_00066092 predicted 838
6 SASI_Rn01_00066093 predicted 6860
7 SASI_Rn01_00066094 predicted 5224
8 SASI_Rn01_00066095 predicted 1624
9 SASI_Rn01_00066096 predicted 1460
10 SASI_Rn02_00266238 predicted 3065
11 SASI_Rn01_00066089 predicted 3373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088176 predicted 1349
2 SASI_Mm01_00088177 predicted 5183
3 SASI_Mm02_00344160 predicted 4669
4 SASI_Mm01_00088178 predicted 1588
5 SASI_Mm01_00088179 predicted 487
6 SASI_Mm01_00088180 predicted 5194
7 SASI_Mm01_00088181 predicted 5362
8 SASI_Mm01_00088182 predicted 1014
9 SASI_Mm01_00088183 predicted 6101
10 SASI_Mm01_00088184 predicted 968
11 SASI_Mm01_00088185 predicted 5654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012295
VALIDATED
CABIN1 MISSION shRNA Bacterial Glycerol Stock
calcineurin binding protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012295.2-6929s1c1
Sequence:CCGGCCTCATGGCATCCTCCCTGTACTCGAGTACAGGGAGGATGCCATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-4699s1c1
Sequence:CCGGCCAGCACTATAAGAGTCTCTACTCGAGTAGAGACTCTTATAGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012295.2-5929s1c1
Sequence:CCGGCCGAGAGAACTTCTTTCCTGTCTCGAGACAGGAAAGAAGTTCTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012295.2-2864s1c1
Sequence:CCGGCTGCGATTCTATGTGCGAGTACTCGAGTACTCGCACATAGAATCGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-6042s1c1
Sequence:CCGGCCGCCACAACTATTATCACCTCTCGAGAGGTGATAATAGTTGTGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-1409s1c1
Sequence:CCGGGAGGAGGAAGATGATTCCTTTCTCGAGAAAGGAATCATCTTCCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-3059s1c1
Sequence:CCGGGCACTGTTCATGTTTGAGTATCTCGAGATACTCAAACATGAACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012295.2-7012s21c1
Sequence:CCGGTGAAGGTGGATTGGTCGCCATCTCGAGATGGCGACCAATCCACCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-1960s21c1
Sequence:CCGGGGAGTTTGTGGTCCGTGTTTACTCGAGTAAACACGGACCACAAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-3304s21c1
Sequence:CCGGCCTCCTGGCTGATTATCATTTCTCGAGAAATGATAATCAGCCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-4192s21c1
Sequence:CCGGTGACCACGATTACGTCAAATGCTCGAGCATTTGACGTAATCGTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-4845s21c1
Sequence:CCGGGCGAGAGGAACAAGACCAATTCTCGAGAATTGGTCTTGTTCCTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012295
VALIDATED
CABIN1 MISSION shRNA shRNA Plasmid DNA
calcineurin binding protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012295.2-6929s1c1
Sequence:CCGGCCTCATGGCATCCTCCCTGTACTCGAGTACAGGGAGGATGCCATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-4699s1c1
Sequence:CCGGCCAGCACTATAAGAGTCTCTACTCGAGTAGAGACTCTTATAGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012295.2-5929s1c1
Sequence:CCGGCCGAGAGAACTTCTTTCCTGTCTCGAGACAGGAAAGAAGTTCTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012295.2-2864s1c1
Sequence:CCGGCTGCGATTCTATGTGCGAGTACTCGAGTACTCGCACATAGAATCGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-6042s1c1
Sequence:CCGGCCGCCACAACTATTATCACCTCTCGAGAGGTGATAATAGTTGTGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-1409s1c1
Sequence:CCGGGAGGAGGAAGATGATTCCTTTCTCGAGAAAGGAATCATCTTCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-3059s1c1
Sequence:CCGGGCACTGTTCATGTTTGAGTATCTCGAGATACTCAAACATGAACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012295.2-7012s21c1
Sequence:CCGGTGAAGGTGGATTGGTCGCCATCTCGAGATGGCGACCAATCCACCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-1960s21c1
Sequence:CCGGGGAGTTTGTGGTCCGTGTTTACTCGAGTAAACACGGACCACAAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-3304s21c1
Sequence:CCGGCCTCCTGGCTGATTATCATTTCTCGAGAAATGATAATCAGCCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-4192s21c1
Sequence:CCGGTGACCACGATTACGTCAAATGCTCGAGCATTTGACGTAATCGTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-4845s21c1
Sequence:CCGGGCGAGAGGAACAAGACCAATTCTCGAGAATTGGTCTTGTTCCTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012295
VALIDATED
CABIN1 MISSION shRNA Lentiviral Transduction Particles
calcineurin binding protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012295.2-6929s1c1
Sequence:CCGGCCTCATGGCATCCTCCCTGTACTCGAGTACAGGGAGGATGCCATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-4699s1c1
Sequence:CCGGCCAGCACTATAAGAGTCTCTACTCGAGTAGAGACTCTTATAGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012295.2-5929s1c1
Sequence:CCGGCCGAGAGAACTTCTTTCCTGTCTCGAGACAGGAAAGAAGTTCTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012295.2-2864s1c1
Sequence:CCGGCTGCGATTCTATGTGCGAGTACTCGAGTACTCGCACATAGAATCGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-6042s1c1
Sequence:CCGGCCGCCACAACTATTATCACCTCTCGAGAGGTGATAATAGTTGTGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-1409s1c1
Sequence:CCGGGAGGAGGAAGATGATTCCTTTCTCGAGAAAGGAATCATCTTCCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012295.2-3059s1c1
Sequence:CCGGGCACTGTTCATGTTTGAGTATCTCGAGATACTCAAACATGAACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012295.2-7012s21c1
Sequence:CCGGTGAAGGTGGATTGGTCGCCATCTCGAGATGGCGACCAATCCACCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-1960s21c1
Sequence:CCGGGGAGTTTGTGGTCCGTGTTTACTCGAGTAAACACGGACCACAAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-3304s21c1
Sequence:CCGGCCTCCTGGCTGATTATCATTTCTCGAGAAATGATAATCAGCCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-4192s21c1
Sequence:CCGGTGACCACGATTACGTCAAATGCTCGAGCATTTGACGTAATCGTGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012295.2-4845s21c1
Sequence:CCGGGCGAGAGGAACAAGACCAATTCTCGAGAATTGGTCTTGTTCCTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172549
VALIDATED
CABIN1 MISSION shRNA Bacterial Glycerol Stock
calcineurin binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172549.2-3394s1c1
Sequence:CCGGGCCCTGTTTATGTTTGAGTATCTCGAGATACTCAAACATAAACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-1914s1c1
Sequence:CCGGCCTGGAGCTTATGATGCGTTACTCGAGTAACGCATCATAAGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-5181s1c1
Sequence:CCGGCGAGAGGAACAAGACCAATTTCTCGAGAAATTGGTCTTGTTCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172549.2-3857s1c1
Sequence:CCGGCCCTTGAGATTGACAGCTCTACTCGAGTAGAGCTGTCAATCTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-7300s1c1
Sequence:CCGGTGACTTTCTTTCCAAGCCCATCTCGAGATGGGCTTGGAAAGAAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172549
VALIDATED
CABIN1 MISSION shRNA shRNA Plasmid DNA
calcineurin binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172549.2-3394s1c1
Sequence:CCGGGCCCTGTTTATGTTTGAGTATCTCGAGATACTCAAACATAAACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-1914s1c1
Sequence:CCGGCCTGGAGCTTATGATGCGTTACTCGAGTAACGCATCATAAGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-5181s1c1
Sequence:CCGGCGAGAGGAACAAGACCAATTTCTCGAGAAATTGGTCTTGTTCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172549.2-3857s1c1
Sequence:CCGGCCCTTGAGATTGACAGCTCTACTCGAGTAGAGCTGTCAATCTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-7300s1c1
Sequence:CCGGTGACTTTCTTTCCAAGCCCATCTCGAGATGGGCTTGGAAAGAAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172549
VALIDATED
CABIN1 MISSION shRNA Lentiviral Transduction Particles
calcineurin binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172549.2-3394s1c1
Sequence:CCGGGCCCTGTTTATGTTTGAGTATCTCGAGATACTCAAACATAAACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-1914s1c1
Sequence:CCGGCCTGGAGCTTATGATGCGTTACTCGAGTAACGCATCATAAGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-5181s1c1
Sequence:CCGGCGAGAGGAACAAGACCAATTTCTCGAGAAATTGGTCTTGTTCCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172549.2-3857s1c1
Sequence:CCGGCCCTTGAGATTGACAGCTCTACTCGAGTAGAGCTGTCAATCTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172549.2-7300s1c1
Sequence:CCGGTGACTTTCTTTCCAAGCCCATCTCGAGATGGGCTTGGAAAGAAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)