EMAIL THIS PAGE TO A FRIEND

CABLES1

Cdk5 and Abl enzyme substrate 1

116 Gene Product Result for
Synonyms: CABL1 CABLES HsT2563 IK3-1
UniProtKB ID: Q8TDN4, B4DK60, Q8N3Y8, Q8NA22, Q9BTG1
Gene ID:
Human(91768) Summary: This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(63955) CDK5 and Abl enzyme substrate 1
Rat(307585) Cdk5 and Abl enzyme substrate 1
domestic guinea pig(100719436) Cdk5 and Abl enzyme substrate 1
naked mole-rat(101712625) Cdk5 and Abl enzyme substrate 1
sheep(101120977) Cdk5 and Abl enzyme substrate 1
Domestic Rabbit(100345850) Cdk5 and Abl enzyme substrate 1
Zebrafish(100126070) Cdk5 and Abl enzyme substrate 1
cow(100138286) Cdk5 and Abl enzyme substrate 1
Horse(100059359) Cdk5 and Abl enzyme substrate 1
domestic cat(101096677) Cdk5 and Abl enzyme substrate 1
dog(100682687) Cdk5 and Abl enzyme substrate 1
chicken(768914) Cdk5 and Abl enzyme substrate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138375 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078681 MISSION® esiRNA esiRNA human CABLES1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100619 Rosetta Predictions human pricing
NM_138375 Rosetta Predictions human pricing
NR_023359 Rosetta Predictions human pricing
NM_001107404 Rosetta Predictions rat pricing
NM_022021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322254 predicted 1331
2 SASI_Hs02_00322255 predicted 1339
3 SASI_Hs02_00322256 predicted 1220
4 SASI_Hs02_00322257 predicted 1508
5 SASI_Hs02_00322258 predicted 1219
6 SASI_Hs02_00322259 predicted 1334
7 SASI_Hs02_00322260 predicted 1514
8 SASI_Hs02_00322261 predicted 1461
9 SASI_Hs02_00322262 predicted 1515
10 SASI_Hs02_00322263 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363488 predicted 618
2 SASI_Hs02_00363489 predicted 615
3 SASI_Hs02_00363490 predicted 502
4 SASI_Hs01_00171292 predicted 783
5 SASI_Hs02_00363491 predicted 499
6 SASI_Hs01_00171293 predicted 624
7 SASI_Hs01_00171296 predicted 802
8 SASI_Hs02_00363492 predicted 740
9 SASI_Hs01_00171298 predicted 804
10 SASI_Hs01_00171299 predicted 460
11 SASI_Hs01_00171290 predicted 1092
12 SASI_Hs01_00171291 predicted 312
13 SASI_Hs01_00171294 predicted 1236
14 SASI_Hs01_00171295 predicted 1070
15 SASI_Hs01_00171297 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381832 predicted 690
2 SASI_Hs02_00381833 predicted 1397
3 SASI_Hs02_00381834 predicted 1721
4 SASI_Hs02_00381835 predicted 394
5 SASI_Hs02_00381836 predicted 1677
6 SASI_Hs02_00381837 predicted 2889
7 SASI_Hs02_00381838 predicted 830
8 SASI_Hs02_00381839 predicted 2324
9 SASI_Hs02_00381840 predicted 398
10 SASI_Hs02_00381841 predicted 2450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228485 predicted 1159
2 SASI_Rn02_00228486 predicted 839
3 SASI_Rn02_00228487 predicted 1468
4 SASI_Rn02_00228488 predicted 1170
5 SASI_Rn02_00228489 predicted 1461
6 SASI_Rn02_00228490 predicted 1387
7 SASI_Rn02_00228491 predicted 1083
8 SASI_Rn02_00228492 predicted 1510
9 SASI_Rn02_00228493 predicted 1088
10 SASI_Rn02_00228494 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050233 predicted 1857
2 SASI_Mm01_00050234 predicted 2121
3 SASI_Mm01_00050235 predicted 1841
4 SASI_Mm01_00050236 predicted 1540
5 SASI_Mm01_00050237 predicted 1758
6 SASI_Mm01_00050238 predicted 1281
7 SASI_Mm02_00326494 predicted 1804
8 SASI_Mm01_00050240 predicted 1261
9 SASI_Mm01_00050241 predicted 1779
10 SASI_Mm02_00326495 predicted 2126
11 SASI_Mm01_00050239 predicted 2146
12 SASI_Mm01_00050242 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138375
VALIDATED
CABLES1 MISSION shRNA Bacterial Glycerol Stock
Cdk5 and Abl enzyme substrate 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-285s21c1
Sequence:CCGGGAATGGCAGAATAGTCCTTATCTCGAGATAAGGACTATTCTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-1020s21c1
Sequence:CCGGACACGAAGTCAAGCATTTAATCTCGAGATTAAATGCTTGACTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-314s21c1
Sequence:CCGGGAAGATCCTTCTGTAGTATATCTCGAGATATACTACAGAAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138375.2-1624s21c1
Sequence:CCGGCAAAGAGTGTGCCAATCTATTCTCGAGAATAGATTGGCACACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-791s21c1
Sequence:CCGGAGGAGAAGTTTCCTCACATTACTCGAGTAATGTGAGGAAACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-1237s1c1
Sequence:CCGGGCACTTACTTACTACTGGAAACTCGAGTTTCCAGTAGTAAGTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138375.1-165s1c1
Sequence:CCGGCCTGGAAGATATTGAGGAGAACTCGAGTTCTCCTCAATATCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-633s1c1
Sequence:CCGGCCTGGGAGACTTTATGGACTACTCGAGTAGTCCATAAAGTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-483s1c1
Sequence:CCGGCCAATTTCTGTTACCCACAAACTCGAGTTTGTGGGTAACAGAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-1087s1c1
Sequence:CCGGGCCTTTGAATTCCCGGTGTTACTCGAGTAACACCGGGAATTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138375
VALIDATED
CABLES1 MISSION shRNA shRNA Plasmid DNA
Cdk5 and Abl enzyme substrate 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-285s21c1
Sequence:CCGGGAATGGCAGAATAGTCCTTATCTCGAGATAAGGACTATTCTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-1020s21c1
Sequence:CCGGACACGAAGTCAAGCATTTAATCTCGAGATTAAATGCTTGACTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-314s21c1
Sequence:CCGGGAAGATCCTTCTGTAGTATATCTCGAGATATACTACAGAAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138375.2-1624s21c1
Sequence:CCGGCAAAGAGTGTGCCAATCTATTCTCGAGAATAGATTGGCACACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-791s21c1
Sequence:CCGGAGGAGAAGTTTCCTCACATTACTCGAGTAATGTGAGGAAACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-1237s1c1
Sequence:CCGGGCACTTACTTACTACTGGAAACTCGAGTTTCCAGTAGTAAGTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138375.1-165s1c1
Sequence:CCGGCCTGGAAGATATTGAGGAGAACTCGAGTTCTCCTCAATATCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-633s1c1
Sequence:CCGGCCTGGGAGACTTTATGGACTACTCGAGTAGTCCATAAAGTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-483s1c1
Sequence:CCGGCCAATTTCTGTTACCCACAAACTCGAGTTTGTGGGTAACAGAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-1087s1c1
Sequence:CCGGGCCTTTGAATTCCCGGTGTTACTCGAGTAACACCGGGAATTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138375
VALIDATED
CABLES1 MISSION shRNA Lentiviral Transduction Particles
Cdk5 and Abl enzyme substrate 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-285s21c1
Sequence:CCGGGAATGGCAGAATAGTCCTTATCTCGAGATAAGGACTATTCTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-1020s21c1
Sequence:CCGGACACGAAGTCAAGCATTTAATCTCGAGATTAAATGCTTGACTTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-314s21c1
Sequence:CCGGGAAGATCCTTCTGTAGTATATCTCGAGATATACTACAGAAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138375.2-1624s21c1
Sequence:CCGGCAAAGAGTGTGCCAATCTATTCTCGAGAATAGATTGGCACACTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138375.2-791s21c1
Sequence:CCGGAGGAGAAGTTTCCTCACATTACTCGAGTAATGTGAGGAAACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-1237s1c1
Sequence:CCGGGCACTTACTTACTACTGGAAACTCGAGTTTCCAGTAGTAAGTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138375.1-165s1c1
Sequence:CCGGCCTGGAAGATATTGAGGAGAACTCGAGTTCTCCTCAATATCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-633s1c1
Sequence:CCGGCCTGGGAGACTTTATGGACTACTCGAGTAGTCCATAAAGTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-483s1c1
Sequence:CCGGCCAATTTCTGTTACCCACAAACTCGAGTTTGTGGGTAACAGAAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138375.1-1087s1c1
Sequence:CCGGGCCTTTGAATTCCCGGTGTTACTCGAGTAACACCGGGAATTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022021
CABLES1 MISSION shRNA Bacterial Glycerol Stock
Cdk5 and Abl enzyme substrate 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022021.1-2998s21c1
Sequence:CCGGCGCGTATATTGTGCTAATTACCTCGAGGTAATTAGCACAATATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1558s21c1
Sequence:CCGGGCCTTTGGGAACCGTAGAAATCTCGAGATTTCTACGGTTCCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1846s1c1
Sequence:CCGGGAGAAGTTTCCTCACATTAAACTCGAGTTTAATGTGAGGAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1466s21c1
Sequence:CCGGTGAGCCTGAAGGAGATCATTGCTCGAGCAATGATCTCCTTCAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1846s21c1
Sequence:CCGGGAGAAGTTTCCTCACATTAAACTCGAGTTTAATGTGAGGAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-713s21c1
Sequence:CCGGTGTCCTTCCTCACCAACATTTCTCGAGAAATGTTGGTGAGGAAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1558s1c1
Sequence:CCGGGCCTTTGGGAACCGTAGAAATCTCGAGATTTCTACGGTTCCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1296s1c1
Sequence:CCGGCCTGGAAGATATTGAAGAGAACTCGAGTTCTCTTCAATATCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022021.1-2973s1c1
Sequence:CCGGGCTCTATGTTAGAGTGCATAACTCGAGTTATGCACTCTAACATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022021
CABLES1 MISSION shRNA shRNA Plasmid DNA
Cdk5 and Abl enzyme substrate 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022021.1-2998s21c1
Sequence:CCGGCGCGTATATTGTGCTAATTACCTCGAGGTAATTAGCACAATATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1558s21c1
Sequence:CCGGGCCTTTGGGAACCGTAGAAATCTCGAGATTTCTACGGTTCCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1846s1c1
Sequence:CCGGGAGAAGTTTCCTCACATTAAACTCGAGTTTAATGTGAGGAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1466s21c1
Sequence:CCGGTGAGCCTGAAGGAGATCATTGCTCGAGCAATGATCTCCTTCAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1846s21c1
Sequence:CCGGGAGAAGTTTCCTCACATTAAACTCGAGTTTAATGTGAGGAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-713s21c1
Sequence:CCGGTGTCCTTCCTCACCAACATTTCTCGAGAAATGTTGGTGAGGAAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1558s1c1
Sequence:CCGGGCCTTTGGGAACCGTAGAAATCTCGAGATTTCTACGGTTCCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1296s1c1
Sequence:CCGGCCTGGAAGATATTGAAGAGAACTCGAGTTCTCTTCAATATCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022021.1-2973s1c1
Sequence:CCGGGCTCTATGTTAGAGTGCATAACTCGAGTTATGCACTCTAACATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022021
CABLES1 MISSION shRNA Lentiviral Transduction Particles
Cdk5 and Abl enzyme substrate 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022021.1-2998s21c1
Sequence:CCGGCGCGTATATTGTGCTAATTACCTCGAGGTAATTAGCACAATATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1558s21c1
Sequence:CCGGGCCTTTGGGAACCGTAGAAATCTCGAGATTTCTACGGTTCCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1846s1c1
Sequence:CCGGGAGAAGTTTCCTCACATTAAACTCGAGTTTAATGTGAGGAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1466s21c1
Sequence:CCGGTGAGCCTGAAGGAGATCATTGCTCGAGCAATGATCTCCTTCAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-1846s21c1
Sequence:CCGGGAGAAGTTTCCTCACATTAAACTCGAGTTTAATGTGAGGAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022021.1-713s21c1
Sequence:CCGGTGTCCTTCCTCACCAACATTTCTCGAGAAATGTTGGTGAGGAAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1558s1c1
Sequence:CCGGGCCTTTGGGAACCGTAGAAATCTCGAGATTTCTACGGTTCCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022021.1-1296s1c1
Sequence:CCGGCCTGGAAGATATTGAAGAGAACTCGAGTTCTCTTCAATATCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022021.1-2973s1c1
Sequence:CCGGGCTCTATGTTAGAGTGCATAACTCGAGTTATGCACTCTAACATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks