EMAIL THIS PAGE TO A FRIEND

CABLES2

Cdk5 and Abl enzyme substrate 2

60 Gene Product Result for
Synonyms: C20orf150 dJ908M14.2 ik3-2
UniProtKB ID: Q9BTV7, Q5JWL0, Q9BYK0
Gene ID:
Mouse(252966) CDK5 and Abl enzyme substrate 2
Rat(311703) Cdk5 and Abl enzyme substrate 2
chicken(419229) Cdk5 and Abl enzyme substrate 2
domestic cat(101083670) Cdk5 and Abl enzyme substrate 2
cow(529805) Cdk5 and Abl enzyme substrate 2
dog(612380) Cdk5 and Abl enzyme substrate 2
sheep(101121191) Cdk5 and Abl enzyme substrate 2
naked mole-rat(101703321) Cdk5 and Abl enzyme substrate 2
domestic guinea pig(100735606) Cdk5 and Abl enzyme substrate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031215 Rosetta Predictions human pricing
XM_001059501 Rosetta Predictions rat pricing
XM_230952 Rosetta Predictions rat pricing
NM_145851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067646 predicted 1588
2 SASI_Hs01_00067647 predicted 1844
3 SASI_Hs01_00067648 predicted 505
4 SASI_Hs02_00358628 predicted 1901
5 SASI_Hs01_00067650 predicted 1375
6 SASI_Hs01_00067651 predicted 668
7 SASI_Hs01_00067652 predicted 966
8 SASI_Hs01_00067653 predicted 1882
9 SASI_Hs02_00358629 predicted 518
10 SASI_Hs02_00358630 predicted 974
11 SASI_Hs01_00067644 predicted 1283
12 SASI_Hs01_00067645 predicted 1284
13 SASI_Hs01_00067649 predicted 1856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293451 predicted 279
2 SASI_Rn02_00293452 predicted 817
3 SASI_Rn02_00293453 predicted 1144
4 SASI_Rn02_00293454 predicted 1155
5 SASI_Rn02_00293455 predicted 589
6 SASI_Rn02_00293456 predicted 902
7 SASI_Rn02_00293457 predicted 885
8 SASI_Rn02_00293458 predicted 803
9 SASI_Rn02_00293459 predicted 517
10 SASI_Rn02_00293460 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386572 predicted 431
2 SASI_Rn02_00386573 predicted 1307
3 SASI_Rn02_00386574 predicted 1317
4 SASI_Rn02_00386575 predicted 741
5 SASI_Rn02_00386576 predicted 1057
6 SASI_Rn02_00386577 predicted 1049
7 SASI_Rn02_00386578 predicted 962
8 SASI_Rn02_00386579 predicted 676
9 SASI_Rn02_00386580 predicted 1395
10 SASI_Rn02_00386581 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051937 predicted 1327
2 SASI_Mm01_00051938 predicted 1226
3 SASI_Mm01_00051939 predicted 660
4 SASI_Mm01_00051940 predicted 985
5 SASI_Mm01_00051941 predicted 1319
6 SASI_Mm01_00051942 predicted 502
7 SASI_Mm01_00051943 predicted 745
8 SASI_Mm01_00051944 predicted 660
9 SASI_Mm01_00051945 predicted 1298
10 SASI_Mm01_00051946 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031215
CABLES2 MISSION shRNA Bacterial Glycerol Stock
Cdk5 and Abl enzyme substrate 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-1391s1c1
Sequence:CCGGGAGAACCAAGTGTTACCTCATCTCGAGATGAGGTAACACTTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-460s1c1
Sequence:CCGGGAGACATAAAGGCCTGAAGAACTCGAGTTCTTCAGGCCTTTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-3454s1c1
Sequence:CCGGCCCTTCAGTTATGTCCCATTTCTCGAGAAATGGGACATAACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031215.1-3428s1c1
Sequence:CCGGCCGGTCTTTGTGATGTGTGAACTCGAGTTCACACATCACAAAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-964s1c1
Sequence:CCGGCCTCATCTTTGCGTCGTACATCTCGAGATGTACGACGCAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-718s1c1
Sequence:CCGGCGTGTCTTATGCGAAGTTCCTCTCGAGAGGAACTTCGCATAAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-2872s1c1
Sequence:CCGGCGCAGAAAGGAGATGCCAATTCTCGAGAATTGGCATCTCCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-3254s1c1
Sequence:CCGGGCCCATGTTACGAGCATGTAACTCGAGTTACATGCTCGTAACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-1064s1c1
Sequence:CCGGGTCAAACTGACGCTGAGCAAACTCGAGTTTGCTCAGCGTCAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031215.1-987s1c1
Sequence:CCGGCCACAGTGATAGAATACGTGACTCGAGTCACGTATTCTATCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-422s1c1
Sequence:CCGGGCTCCAGCACAGAGAACCAAACTCGAGTTTGGTTCTCTGTGCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031215.1-1300s1c1
Sequence:CCGGGTTAGAAGAAAGGTTTCGATTCTCGAGAATCGAAACCTTTCTTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031215
CABLES2 MISSION shRNA shRNA Plasmid DNA
Cdk5 and Abl enzyme substrate 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-1391s1c1
Sequence:CCGGGAGAACCAAGTGTTACCTCATCTCGAGATGAGGTAACACTTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-460s1c1
Sequence:CCGGGAGACATAAAGGCCTGAAGAACTCGAGTTCTTCAGGCCTTTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-3454s1c1
Sequence:CCGGCCCTTCAGTTATGTCCCATTTCTCGAGAAATGGGACATAACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031215.1-3428s1c1
Sequence:CCGGCCGGTCTTTGTGATGTGTGAACTCGAGTTCACACATCACAAAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-964s1c1
Sequence:CCGGCCTCATCTTTGCGTCGTACATCTCGAGATGTACGACGCAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-718s1c1
Sequence:CCGGCGTGTCTTATGCGAAGTTCCTCTCGAGAGGAACTTCGCATAAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-2872s1c1
Sequence:CCGGCGCAGAAAGGAGATGCCAATTCTCGAGAATTGGCATCTCCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-3254s1c1
Sequence:CCGGGCCCATGTTACGAGCATGTAACTCGAGTTACATGCTCGTAACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-1064s1c1
Sequence:CCGGGTCAAACTGACGCTGAGCAAACTCGAGTTTGCTCAGCGTCAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031215.1-987s1c1
Sequence:CCGGCCACAGTGATAGAATACGTGACTCGAGTCACGTATTCTATCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-422s1c1
Sequence:CCGGGCTCCAGCACAGAGAACCAAACTCGAGTTTGGTTCTCTGTGCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031215.1-1300s1c1
Sequence:CCGGGTTAGAAGAAAGGTTTCGATTCTCGAGAATCGAAACCTTTCTTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031215
CABLES2 MISSION shRNA Lentiviral Transduction Particles
Cdk5 and Abl enzyme substrate 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-1391s1c1
Sequence:CCGGGAGAACCAAGTGTTACCTCATCTCGAGATGAGGTAACACTTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-460s1c1
Sequence:CCGGGAGACATAAAGGCCTGAAGAACTCGAGTTCTTCAGGCCTTTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-3454s1c1
Sequence:CCGGCCCTTCAGTTATGTCCCATTTCTCGAGAAATGGGACATAACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031215.1-3428s1c1
Sequence:CCGGCCGGTCTTTGTGATGTGTGAACTCGAGTTCACACATCACAAAGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-964s1c1
Sequence:CCGGCCTCATCTTTGCGTCGTACATCTCGAGATGTACGACGCAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-718s1c1
Sequence:CCGGCGTGTCTTATGCGAAGTTCCTCTCGAGAGGAACTTCGCATAAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-2872s1c1
Sequence:CCGGCGCAGAAAGGAGATGCCAATTCTCGAGAATTGGCATCTCCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031215.1-3254s1c1
Sequence:CCGGGCCCATGTTACGAGCATGTAACTCGAGTTACATGCTCGTAACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-1064s1c1
Sequence:CCGGGTCAAACTGACGCTGAGCAAACTCGAGTTTGCTCAGCGTCAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031215.1-987s1c1
Sequence:CCGGCCACAGTGATAGAATACGTGACTCGAGTCACGTATTCTATCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031215.1-422s1c1
Sequence:CCGGGCTCCAGCACAGAGAACCAAACTCGAGTTTGGTTCTCTGTGCTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031215.1-1300s1c1
Sequence:CCGGGTTAGAAGAAAGGTTTCGATTCTCGAGAATCGAAACCTTTCTTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145851
VALIDATED
CABLES2 MISSION shRNA Bacterial Glycerol Stock
Cdk5 and Abl enzyme substrate 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145851.1-307s1c1
Sequence:CCGGCGCCCTCTTCTTTCTCAACAACTCGAGTTGTTGAGAAAGAAGAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145851.1-1735s1c1
Sequence:CCGGGCTTGGCTTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145851.1-998s1c1
Sequence:CCGGCCACCAGGTTCAAGACACAAACTCGAGTTTGTGTCTTGAACCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-905s1c1
Sequence:CCGGGCAAAGTTCCTGTACCCTACTCTCGAGAGTAGGGTACAGGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-929s1c1
Sequence:CCGGGCTCTGGTTATACACAAGAATCTCGAGATTCTTGTGTATAACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-1340s1c1
Sequence:CCGGGTGTACTTTGAGAAGCTCGTACTCGAGTACGAGCTTCTCAAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-1166s21c1
Sequence:CCGGGTGTACTTTGAGAAGCTCGTACTCGAGTACGAGCTTCTCAAAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-755s21c1
Sequence:CCGGGCTCTGGTTATACACAAGAATCTCGAGATTCTTGTGTATAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145851.2-1561s21c1
Sequence:CCGGGCTTGGCTTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-731s21c1
Sequence:CCGGGCAAAGTTCCTGTACCCTACTCTCGAGAGTAGGGTACAGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145851
VALIDATED
CABLES2 MISSION shRNA shRNA Plasmid DNA
Cdk5 and Abl enzyme substrate 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145851.1-307s1c1
Sequence:CCGGCGCCCTCTTCTTTCTCAACAACTCGAGTTGTTGAGAAAGAAGAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145851.1-1735s1c1
Sequence:CCGGGCTTGGCTTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145851.1-998s1c1
Sequence:CCGGCCACCAGGTTCAAGACACAAACTCGAGTTTGTGTCTTGAACCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-905s1c1
Sequence:CCGGGCAAAGTTCCTGTACCCTACTCTCGAGAGTAGGGTACAGGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-929s1c1
Sequence:CCGGGCTCTGGTTATACACAAGAATCTCGAGATTCTTGTGTATAACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-1340s1c1
Sequence:CCGGGTGTACTTTGAGAAGCTCGTACTCGAGTACGAGCTTCTCAAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-1166s21c1
Sequence:CCGGGTGTACTTTGAGAAGCTCGTACTCGAGTACGAGCTTCTCAAAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-755s21c1
Sequence:CCGGGCTCTGGTTATACACAAGAATCTCGAGATTCTTGTGTATAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145851.2-1561s21c1
Sequence:CCGGGCTTGGCTTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-731s21c1
Sequence:CCGGGCAAAGTTCCTGTACCCTACTCTCGAGAGTAGGGTACAGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145851
VALIDATED
CABLES2 MISSION shRNA Lentiviral Transduction Particles
Cdk5 and Abl enzyme substrate 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145851.1-307s1c1
Sequence:CCGGCGCCCTCTTCTTTCTCAACAACTCGAGTTGTTGAGAAAGAAGAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145851.1-1735s1c1
Sequence:CCGGGCTTGGCTTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145851.1-998s1c1
Sequence:CCGGCCACCAGGTTCAAGACACAAACTCGAGTTTGTGTCTTGAACCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-905s1c1
Sequence:CCGGGCAAAGTTCCTGTACCCTACTCTCGAGAGTAGGGTACAGGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-929s1c1
Sequence:CCGGGCTCTGGTTATACACAAGAATCTCGAGATTCTTGTGTATAACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145851.1-1340s1c1
Sequence:CCGGGTGTACTTTGAGAAGCTCGTACTCGAGTACGAGCTTCTCAAAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-1166s21c1
Sequence:CCGGGTGTACTTTGAGAAGCTCGTACTCGAGTACGAGCTTCTCAAAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-755s21c1
Sequence:CCGGGCTCTGGTTATACACAAGAATCTCGAGATTCTTGTGTATAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145851.2-1561s21c1
Sequence:CCGGGCTTGGCTTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145851.2-731s21c1
Sequence:CCGGGCAAAGTTCCTGTACCCTACTCTCGAGAGTAGGGTACAGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks