EMAIL THIS PAGE TO A FRIEND

CABP1

calcium binding protein 1

101 Gene Product Result for
Synonyms: CALBRAIN HCALB_BR
UniProtKB ID: Q9NZU7, O95663, Q8N6H5, Q9NZU8
Gene ID:
Human(9478) Summary: Calcium binding proteins are an important component of calcium mediated cellular signal transduction. This gene encodes a protein that belongs to a subfamily of calcium binding proteins which share similarity to calmodulin. The protein encoded by this gene regulates the gating of voltage-gated calcium ion channels. This protein inhibits calcium-dependent inactivation and supports calcium-dependent facilitation of ion channels containing voltage-dependent L-type calcium channel subunit alpha-1C. This protein also regulates calcium-dependent activity of inositol 1,4,5-triphosphate receptors, P/Q-type voltage-gated calcium channels, and transient receptor potential channel TRPC5. This gene is predominantly expressed in retina and brain. Alternative splicing results in multiple transcript variants encoding disinct isoforms. [provided by RefSeq, Jul 2012]
Mouse(29867) calcium binding protein 1
Rat(171051) calcium binding protein 1
fruit fly(34976) calcium-binding protein 1
chicken(770178) calcium binding protein 1
domestic cat(101082189) calcium binding protein 1
cow(281653) calcium binding protein 1
dog(477516) calcium binding protein 1
domestic guinea pig(100730963) calcium binding protein 1
naked mole-rat(101724754) calcium binding protein 1
sheep(101112516) calcium binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033677 Rosetta Predictions human pricing
NM_004276 Rosetta Predictions human pricing
NM_031205 Rosetta Predictions human pricing
NM_001033675 Rosetta Predictions rat pricing
NM_001033676 Rosetta Predictions rat pricing
NM_133529 Rosetta Predictions rat pricing
NM_013879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100892 predicted 955
2 SASI_Hs01_00100893 predicted 989
3 SASI_Hs02_00308083 predicted 991
4 SASI_Hs01_00100894 predicted 1154
5 SASI_Hs01_00100895 predicted 956
6 SASI_Hs01_00100896 predicted 986
7 SASI_Hs01_00100897 predicted 1353
8 SASI_Hs01_00100898 predicted 1347
9 SASI_Hs01_00100899 predicted 1220
10 SASI_Hs01_00100900 predicted 1216
11 SASI_Hs01_00100901 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112124 predicted 356
2 SASI_Hs01_00112125 predicted 375
3 SASI_Hs02_00337258 predicted 380
4 SASI_Hs01_00112126 predicted 553
5 SASI_Hs01_00112127 predicted 352
6 SASI_Hs01_00112128 predicted 374
7 SASI_Hs01_00112129 predicted 746
8 SASI_Hs01_00112130 predicted 740
9 SASI_Hs01_00112131 predicted 615
10 SASI_Hs01_00112132 predicted 614
11 SASI_Hs01_00112133 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082673 predicted 532
2 SASI_Hs01_00082674 predicted 559
3 SASI_Hs02_00358609 predicted 557
4 SASI_Hs01_00082675 predicted 736
5 SASI_Hs01_00082676 predicted 532
6 SASI_Hs01_00082677 predicted 552
7 SASI_Hs01_00082678 predicted 919
8 SASI_Hs01_00082679 predicted 920
9 SASI_Hs01_00082680 predicted 795
10 SASI_Hs01_00082681 predicted 792
11 SASI_Hs01_00082682 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111469 predicted 675
2 SASI_Rn01_00111470 predicted 282
3 SASI_Rn01_00111471 predicted 278
4 SASI_Rn01_00111472 predicted 295
5 SASI_Rn01_00111473 predicted 259
6 SASI_Rn01_00111474 predicted 658
7 SASI_Rn01_00111475 predicted 305
8 SASI_Rn01_00111477 predicted 670
9 SASI_Rn01_00111478 predicted 285
10 SASI_Rn02_00203685 predicted 658
11 SASI_Rn01_00111476 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087222 predicted 1287
2 SASI_Rn01_00087223 predicted 897
3 SASI_Rn01_00087224 predicted 888
4 SASI_Rn01_00087225 predicted 907
5 SASI_Rn01_00087226 predicted 868
6 SASI_Rn01_00087227 predicted 1268
7 SASI_Rn01_00087228 predicted 916
8 SASI_Rn01_00087230 predicted 1285
9 SASI_Rn01_00087231 predicted 893
10 SASI_Rn02_00203686 predicted 1278
11 SASI_Rn01_00087229 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112413 predicted 855
2 SASI_Rn01_00112414 predicted 458
3 SASI_Rn01_00112415 predicted 455
4 SASI_Rn01_00112416 predicted 475
5 SASI_Rn01_00112417 predicted 438
6 SASI_Rn01_00112418 predicted 843
7 SASI_Rn01_00112419 predicted 486
8 SASI_Rn01_00112421 predicted 850
9 SASI_Rn01_00112422 predicted 460
10 SASI_Rn02_00267710 predicted 839
11 SASI_Rn01_00112420 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036787 predicted 337
2 SASI_Mm01_00036788 predicted 524
3 SASI_Mm02_00322904 predicted 658
4 SASI_Mm01_00036789 predicted 564
5 SASI_Mm01_00036790 predicted 489
6 SASI_Mm01_00036791 predicted 344
7 SASI_Mm01_00036792 predicted 290
8 SASI_Mm01_00036793 predicted 283
9 SASI_Mm01_00036794 predicted 278
10 SASI_Mm01_00036796 predicted 200
11 SASI_Mm01_00036795 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031205
CABP1 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031205.2-913s21c1
Sequence:CCGCTCCGCACTGTGAAAGACTAACCTCGAGGTTAGTCTTTCACAGTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031205.2-533s21c1
Sequence:CCGGACAGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-563s1c1
Sequence:CCGGCGAGATGCTTTCCGAGAGTTTCTCGAGAAACTCTCGGAAAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-664s1c1
Sequence:CCGGCCGAGACATAGAGGAAATTATCTCGAGATAATTTCCTCTATGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-448s1c1
Sequence:CCGGGTCCCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-97s1c1
Sequence:CCGGGAGAAATCTCTCAAGGAAGATCTCGAGATCTTCCTTGAGAGATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-305s1c1
Sequence:CCGGCTGCGACCAGAGGAAATTGAACTCGAGTTCAATTTCCTCTGGTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031205
CABP1 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031205.2-913s21c1
Sequence:CCGCTCCGCACTGTGAAAGACTAACCTCGAGGTTAGTCTTTCACAGTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031205.2-533s21c1
Sequence:CCGGACAGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-563s1c1
Sequence:CCGGCGAGATGCTTTCCGAGAGTTTCTCGAGAAACTCTCGGAAAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-664s1c1
Sequence:CCGGCCGAGACATAGAGGAAATTATCTCGAGATAATTTCCTCTATGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-448s1c1
Sequence:CCGGGTCCCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-97s1c1
Sequence:CCGGGAGAAATCTCTCAAGGAAGATCTCGAGATCTTCCTTGAGAGATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-305s1c1
Sequence:CCGGCTGCGACCAGAGGAAATTGAACTCGAGTTCAATTTCCTCTGGTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031205
CABP1 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031205.2-913s21c1
Sequence:CCGCTCCGCACTGTGAAAGACTAACCTCGAGGTTAGTCTTTCACAGTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031205.2-533s21c1
Sequence:CCGGACAGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-563s1c1
Sequence:CCGGCGAGATGCTTTCCGAGAGTTTCTCGAGAAACTCTCGGAAAGCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-664s1c1
Sequence:CCGGCCGAGACATAGAGGAAATTATCTCGAGATAATTTCCTCTATGTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-448s1c1
Sequence:CCGGGTCCCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-97s1c1
Sequence:CCGGGAGAAATCTCTCAAGGAAGATCTCGAGATCTTCCTTGAGAGATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031205.2-305s1c1
Sequence:CCGGCTGCGACCAGAGGAAATTGAACTCGAGTTCAATTTCCTCTGGTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013879
VALIDATED
CABP1 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013879.2-443s21c1
Sequence:CCGGGTCTCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-277s21c1
Sequence:CCGGAGAACAGACAACCTGACAGATCTCGAGATCTGTCAGGTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-528s21c1
Sequence:CCGGACGGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-909s21c1
Sequence:CCGGTCCGCACTGTGAAAGACTCACCTCGAGGTGAGTCTTTCACAGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-496s21c1
Sequence:CCGGTGGAACTGATGGGCCCTAAACCTCGAGGTTTAGGGCCCATCAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-338s1c1
Sequence:CCGGCCGAGAATTTGACAAAGACAACTCGAGTTGTCTTTGTCAAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-659s1c1
Sequence:CCGGCCGGGACATAGAGGAAATTATCTCGAGATAATTTCCTCTATGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-528s1c1
Sequence:CCGGACGGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-443s1c1
Sequence:CCGGGTCTCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-277s1c1
Sequence:CCGGAGAACAGACAACCTGACAGATCTCGAGATCTGTCAGGTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013879
VALIDATED
CABP1 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013879.2-443s21c1
Sequence:CCGGGTCTCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-277s21c1
Sequence:CCGGAGAACAGACAACCTGACAGATCTCGAGATCTGTCAGGTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-528s21c1
Sequence:CCGGACGGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-909s21c1
Sequence:CCGGTCCGCACTGTGAAAGACTCACCTCGAGGTGAGTCTTTCACAGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-496s21c1
Sequence:CCGGTGGAACTGATGGGCCCTAAACCTCGAGGTTTAGGGCCCATCAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-338s1c1
Sequence:CCGGCCGAGAATTTGACAAAGACAACTCGAGTTGTCTTTGTCAAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-659s1c1
Sequence:CCGGCCGGGACATAGAGGAAATTATCTCGAGATAATTTCCTCTATGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-528s1c1
Sequence:CCGGACGGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-443s1c1
Sequence:CCGGGTCTCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-277s1c1
Sequence:CCGGAGAACAGACAACCTGACAGATCTCGAGATCTGTCAGGTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013879
VALIDATED
CABP1 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013879.2-443s21c1
Sequence:CCGGGTCTCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-277s21c1
Sequence:CCGGAGAACAGACAACCTGACAGATCTCGAGATCTGTCAGGTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-528s21c1
Sequence:CCGGACGGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-909s21c1
Sequence:CCGGTCCGCACTGTGAAAGACTCACCTCGAGGTGAGTCTTTCACAGTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013879.2-496s21c1
Sequence:CCGGTGGAACTGATGGGCCCTAAACCTCGAGGTTTAGGGCCCATCAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-338s1c1
Sequence:CCGGCCGAGAATTTGACAAAGACAACTCGAGTTGTCTTTGTCAAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-659s1c1
Sequence:CCGGCCGGGACATAGAGGAAATTATCTCGAGATAATTTCCTCTATGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-528s1c1
Sequence:CCGGACGGCAGATATGATTGGTGTACTCGAGTACACCAATCATATCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-443s1c1
Sequence:CCGGGTCTCAGCAGATCAACATGAACTCGAGTTCATGTTGATCTGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013879.1-277s1c1
Sequence:CCGGAGAACAGACAACCTGACAGATCTCGAGATCTGTCAGGTTGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks