EMAIL THIS PAGE TO A FRIEND

CABP2

calcium binding protein 2

59 Gene Product Result for
Synonyms: DFNB93
UniProtKB ID: Q9NPB3
Gene ID:
Human(51475) Summary: This gene belongs to a subfamily of calcium binding proteins that share similarity to calmodulin. Like calmodulin, these family members can likely stimulate calmodulin-dependent kinase II and the protein phosphatase calcineurin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction.[provided by RefSeq, Nov 2010]
Mouse(29866) calcium binding protein 2
Rat(499298) calcium binding protein 2
chicken(429967) calcium binding protein 2
dog(611821) calcium binding protein 2
domestic cat(101093143) calcium binding protein 2
cow(281654) calcium binding protein 2
Horse(100053196) calcium binding protein 2
sheep(101120205) calcium binding protein 2
naked mole-rat(101698250) calcium binding protein 2
domestic guinea pig(100725193) calcium binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305896 ANTI-CABP2(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035971 MISSION® esiRNA esiRNA targeting mouse Cabp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016366 Rosetta Predictions human pricing
NM_031204 Rosetta Predictions human pricing
XM_001070324 Rosetta Predictions rat pricing
XM_574595 Rosetta Predictions rat pricing
NM_013878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226619 predicted 530
2 SASI_Hs01_00226620 predicted 717
3 SASI_Hs01_00226621 predicted 714
4 SASI_Hs02_00349351 predicted 732
5 SASI_Hs01_00226622 predicted 723
6 SASI_Hs01_00226623 predicted 720
7 SASI_Hs01_00226625 predicted 714
8 SASI_Hs01_00226626 predicted 569
9 SASI_Hs01_00226627 predicted 578
10 SASI_Hs01_00226628 predicted 730
11 SASI_Hs01_00226624 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062928 predicted 363
2 SASI_Hs01_00062929 predicted 540
3 SASI_Hs01_00062930 predicted 545
4 SASI_Hs02_00358608 predicted 564
5 SASI_Hs01_00062931 predicted 549
6 SASI_Hs01_00062932 predicted 544
7 SASI_Hs01_00062934 predicted 550
8 SASI_Hs01_00062935 predicted 400
9 SASI_Hs01_00062936 predicted 403
10 SASI_Hs01_00062937 predicted 553
11 SASI_Hs01_00062933 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331248 predicted 641
2 SASI_Rn02_00331249 predicted 280
3 SASI_Rn02_00331250 predicted 702
4 SASI_Rn02_00331251 predicted 666
5 SASI_Rn02_00331252 predicted 416
6 SASI_Rn02_00331253 predicted 322
7 SASI_Rn02_00331254 predicted 668
8 SASI_Rn02_00331255 predicted 294
9 SASI_Rn02_00331256 predicted 443
10 SASI_Rn02_00331257 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402266 predicted 647
2 SASI_Rn02_00402267 predicted 272
3 SASI_Rn02_00402268 predicted 705
4 SASI_Rn02_00402269 predicted 665
5 SASI_Rn02_00402270 predicted 413
6 SASI_Rn02_00402271 predicted 321
7 SASI_Rn02_00402272 predicted 669
8 SASI_Rn02_00402273 predicted 292
9 SASI_Rn02_00402274 predicted 444
10 SASI_Rn02_00402275 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177489 predicted 423
2 SASI_Mm01_00177490 predicted 284
3 SASI_Mm01_00177491 predicted 205
4 SASI_Mm01_00177492 predicted 501
5 SASI_Mm01_00177493 predicted 549
6 SASI_Mm01_00177494 predicted 410
7 SASI_Mm01_00177495 predicted 273
8 SASI_Mm01_00177497 predicted 243
9 SASI_Mm02_00322903 predicted 201
10 SASI_Mm01_00177496 predicted 295
11 SASI_Mm01_00177488 predicted 495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016366
CABP2 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-427s1c1
Sequence:CCGGCATCGAGATCTCACAGCAAATCTCGAGATTTGCTGTGAGATCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-692s1c1
Sequence:CCGGCTGGTCGACTTCGAAGAGTTTCTCGAGAAACTCTTCGAAGTCGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-205s1c1
Sequence:CCGGCCAGGGCTACTCGGTGCTCAACTCGAGTTGAGCACCGAGTAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-703s1c1
Sequence:CCGGCGAAGAGTTTGTGCGAATGATCTCGAGATCATTCGCACAAACTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-502s1c1
Sequence:CCGGGCTGGCAGAGACGGCAGACATCTCGAGATGTCTGCCGTCTCTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016366
CABP2 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-427s1c1
Sequence:CCGGCATCGAGATCTCACAGCAAATCTCGAGATTTGCTGTGAGATCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-692s1c1
Sequence:CCGGCTGGTCGACTTCGAAGAGTTTCTCGAGAAACTCTTCGAAGTCGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-205s1c1
Sequence:CCGGCCAGGGCTACTCGGTGCTCAACTCGAGTTGAGCACCGAGTAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-703s1c1
Sequence:CCGGCGAAGAGTTTGTGCGAATGATCTCGAGATCATTCGCACAAACTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-502s1c1
Sequence:CCGGGCTGGCAGAGACGGCAGACATCTCGAGATGTCTGCCGTCTCTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016366
CABP2 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-427s1c1
Sequence:CCGGCATCGAGATCTCACAGCAAATCTCGAGATTTGCTGTGAGATCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-692s1c1
Sequence:CCGGCTGGTCGACTTCGAAGAGTTTCTCGAGAAACTCTTCGAAGTCGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-205s1c1
Sequence:CCGGCCAGGGCTACTCGGTGCTCAACTCGAGTTGAGCACCGAGTAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-703s1c1
Sequence:CCGGCGAAGAGTTTGTGCGAATGATCTCGAGATCATTCGCACAAACTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016366.1-502s1c1
Sequence:CCGGGCTGGCAGAGACGGCAGACATCTCGAGATGTCTGCCGTCTCTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013878
CABP2 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013878.1-782s1c1
Sequence:CCGGCGAATTGCAGAGGATCCTATACTCGAGTATAGGATCCTCTGCAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-424s1c1
Sequence:CCGGGAGCTCATTGAGATATCACAACTCGAGTTGTGATATCTCAATGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-643s1c1
Sequence:CCGGCAACGGGAAGTAGATGAGATACTCGAGTATCTCATCTACTTCCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-694s1c1
Sequence:CCGGCTGGTTGACTTTGAAGAATTTCTCGAGAAATTCTTCAAAGTCAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-655s1c1
Sequence:CCGGGATGAGATACTCCAAGACATTCTCGAGAATGTCTTGGAGTATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013878
CABP2 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013878.1-782s1c1
Sequence:CCGGCGAATTGCAGAGGATCCTATACTCGAGTATAGGATCCTCTGCAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-424s1c1
Sequence:CCGGGAGCTCATTGAGATATCACAACTCGAGTTGTGATATCTCAATGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-643s1c1
Sequence:CCGGCAACGGGAAGTAGATGAGATACTCGAGTATCTCATCTACTTCCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-694s1c1
Sequence:CCGGCTGGTTGACTTTGAAGAATTTCTCGAGAAATTCTTCAAAGTCAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-655s1c1
Sequence:CCGGGATGAGATACTCCAAGACATTCTCGAGAATGTCTTGGAGTATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013878
CABP2 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013878.1-782s1c1
Sequence:CCGGCGAATTGCAGAGGATCCTATACTCGAGTATAGGATCCTCTGCAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-424s1c1
Sequence:CCGGGAGCTCATTGAGATATCACAACTCGAGTTGTGATATCTCAATGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-643s1c1
Sequence:CCGGCAACGGGAAGTAGATGAGATACTCGAGTATCTCATCTACTTCCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-694s1c1
Sequence:CCGGCTGGTTGACTTTGAAGAATTTCTCGAGAAATTCTTCAAAGTCAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013878.1-655s1c1
Sequence:CCGGGATGAGATACTCCAAGACATTCTCGAGAATGTCTTGGAGTATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)