EMAIL THIS PAGE TO A FRIEND

CABP5

calcium binding protein 5

45 Gene Product Result for
Synonyms: CABP3
UniProtKB ID: Q9NP86, A0AUY4
Gene ID:
Human(56344) Summary: The product of this gene belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of this gene is retina-specific. The mouse homolog of this protein has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of this gene is unknown. [provided by RefSeq, Oct 2009]
Mouse(29865) calcium binding protein 5
Rat(365194) calcium binding protein 5
sheep(101120597) calcium binding protein 5
naked mole-rat(101713447) calcium binding protein 5
domestic guinea pig(100730675) calcium binding protein 5
cow(282715) calcium binding protein 5
domestic cat(101088201) calcium binding protein 5
dog(484414) calcium binding protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019855 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026121 MISSION® esiRNA esiRNA targeting mouse Cabp5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019855 Rosetta Predictions human pricing
NM_001108907 Rosetta Predictions rat pricing
NM_013877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193428 predicted 791
2 SASI_Hs01_00193429 predicted 260
3 SASI_Hs01_00193430 predicted 351
4 SASI_Hs01_00193431 predicted 369
5 SASI_Hs01_00193432 predicted 833
6 SASI_Hs01_00193433 predicted 246
7 SASI_Hs01_00193434 predicted 427
8 SASI_Hs01_00193435 predicted 580
9 SASI_Hs01_00193437 predicted 286
10 SASI_Hs02_00352873 predicted 464
11 SASI_Hs01_00193436 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243265 predicted 493
2 SASI_Rn02_00243266 predicted 616
3 SASI_Rn02_00243267 predicted 905
4 SASI_Rn02_00243268 predicted 415
5 SASI_Rn02_00243269 predicted 873
6 SASI_Rn02_00243270 predicted 897
7 SASI_Rn02_00243271 predicted 524
8 SASI_Rn02_00243272 predicted 646
9 SASI_Rn02_00243273 predicted 965
10 SASI_Rn02_00243274 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114571 predicted 845
2 SASI_Mm01_00114572 predicted 458
3 SASI_Mm01_00114573 predicted 433
4 SASI_Mm01_00114574 predicted 613
5 SASI_Mm01_00114575 predicted 875
6 SASI_Mm01_00114576 predicted 384
7 SASI_Mm02_00322902 predicted 281
8 SASI_Mm01_00114577 predicted 835
9 SASI_Mm01_00114578 predicted 488
10 SASI_Mm01_00114579 predicted 328
11 SASI_Mm01_00114580 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019855
CABP5 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019855.3-801s21c1
Sequence:CCGGAGACCCAGAGCGGTATCTTTGCTCGAGCAAAGATACCGCTCTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019855.3-466s21c1
Sequence:CCGGTCAAGGAGTTTGACACGAATGCTCGAGCATTCGTGTCAAACTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-195s1c1
Sequence:CCGGCCACTGGGACAAGATGAGATTCTCGAGAATCTCATCTTGTCCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-344s1c1
Sequence:CCGGCCAGCAAATCCGCATGAACTTCTCGAGAAGTTCATGCGGATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-605s1c1
Sequence:CCGGCACAGTTGACTTTGAAGAGTTCTCGAGAACTCTTCAAAGTCAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-240s1c1
Sequence:CCGGGAGTTCGATAAGGACCGAGATCTCGAGATCTCGGTCCTTATCGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-315s1c1
Sequence:CCGGCCCACGGAGATGGAACTGATTCTCGAGAATCAGTTCCATCTCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019855
CABP5 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019855.3-801s21c1
Sequence:CCGGAGACCCAGAGCGGTATCTTTGCTCGAGCAAAGATACCGCTCTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019855.3-466s21c1
Sequence:CCGGTCAAGGAGTTTGACACGAATGCTCGAGCATTCGTGTCAAACTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-195s1c1
Sequence:CCGGCCACTGGGACAAGATGAGATTCTCGAGAATCTCATCTTGTCCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-344s1c1
Sequence:CCGGCCAGCAAATCCGCATGAACTTCTCGAGAAGTTCATGCGGATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-605s1c1
Sequence:CCGGCACAGTTGACTTTGAAGAGTTCTCGAGAACTCTTCAAAGTCAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-240s1c1
Sequence:CCGGGAGTTCGATAAGGACCGAGATCTCGAGATCTCGGTCCTTATCGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-315s1c1
Sequence:CCGGCCCACGGAGATGGAACTGATTCTCGAGAATCAGTTCCATCTCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019855
CABP5 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019855.3-801s21c1
Sequence:CCGGAGACCCAGAGCGGTATCTTTGCTCGAGCAAAGATACCGCTCTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019855.3-466s21c1
Sequence:CCGGTCAAGGAGTTTGACACGAATGCTCGAGCATTCGTGTCAAACTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-195s1c1
Sequence:CCGGCCACTGGGACAAGATGAGATTCTCGAGAATCTCATCTTGTCCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-344s1c1
Sequence:CCGGCCAGCAAATCCGCATGAACTTCTCGAGAAGTTCATGCGGATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-605s1c1
Sequence:CCGGCACAGTTGACTTTGAAGAGTTCTCGAGAACTCTTCAAAGTCAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-240s1c1
Sequence:CCGGGAGTTCGATAAGGACCGAGATCTCGAGATCTCGGTCCTTATCGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019855.3-315s1c1
Sequence:CCGGCCCACGGAGATGGAACTGATTCTCGAGAATCAGTTCCATCTCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013877
CABP5 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-254s1c1
Sequence:CCGGCGGGAAGCATTTCTTGAATTTCTCGAGAAATTCAAGAAATGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-322s1c1
Sequence:CCGGCATGAGAACGATGGGTTACATCTCGAGATGTAACCCATCGTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-493s1c1
Sequence:CCGGCTTCAAGGAGTTTGATGCCAACTCGAGTTGGCATCAAACTCCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-634s1c1
Sequence:CCGGCACTGTTGACTTTGAAGAGTTCTCGAGAACTCTTCAAAGTCAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-292s1c1
Sequence:CCGGGTTCATCTCTTACAAGGATTTCTCGAGAAATCCTTGTAAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013877
CABP5 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-254s1c1
Sequence:CCGGCGGGAAGCATTTCTTGAATTTCTCGAGAAATTCAAGAAATGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-322s1c1
Sequence:CCGGCATGAGAACGATGGGTTACATCTCGAGATGTAACCCATCGTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-493s1c1
Sequence:CCGGCTTCAAGGAGTTTGATGCCAACTCGAGTTGGCATCAAACTCCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-634s1c1
Sequence:CCGGCACTGTTGACTTTGAAGAGTTCTCGAGAACTCTTCAAAGTCAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-292s1c1
Sequence:CCGGGTTCATCTCTTACAAGGATTTCTCGAGAAATCCTTGTAAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013877
CABP5 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-254s1c1
Sequence:CCGGCGGGAAGCATTTCTTGAATTTCTCGAGAAATTCAAGAAATGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-322s1c1
Sequence:CCGGCATGAGAACGATGGGTTACATCTCGAGATGTAACCCATCGTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-493s1c1
Sequence:CCGGCTTCAAGGAGTTTGATGCCAACTCGAGTTGGCATCAAACTCCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-634s1c1
Sequence:CCGGCACTGTTGACTTTGAAGAGTTCTCGAGAACTCTTCAAAGTCAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013877.2-292s1c1
Sequence:CCGGGTTCATCTCTTACAAGGATTTCTCGAGAAATCCTTGTAAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks