EMAIL THIS PAGE TO A FRIEND

CABP7

calcium binding protein 7

71 Gene Product Result for
Synonyms: CALN2
UniProtKB ID: Q86V35
Gene ID:
Mouse(192650) calcium binding protein 7
Rat(360970) calcium binding protein 7
chicken(770960) calcium binding protein 7
cow(616078) calcium binding protein 7
domestic cat(101094137) calcium binding protein 7
dog(486346) calcium binding protein 7
domestic guinea pig(100725516) calcium binding protein 7
naked mole-rat(101706952) calcium binding protein 7
sheep(101122220) calcium binding protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182527 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182527 Rosetta Predictions human pricing
NM_001007730 Rosetta Predictions rat pricing
XM_001067765 Rosetta Predictions rat pricing
NM_138948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089439 predicted 503
2 SASI_Hs01_00089440 predicted 313
3 SASI_Hs02_00370618 predicted 346
4 SASI_Hs01_00089441 predicted 808
5 SASI_Hs01_00089442 predicted 407
6 SASI_Hs01_00089443 predicted 970
7 SASI_Hs01_00089444 predicted 1085
8 SASI_Hs01_00089445 predicted 607
9 SASI_Hs01_00089446 predicted 610
10 SASI_Hs01_00089447 predicted 957
11 SASI_Hs01_00089448 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053484 predicted 780
2 SASI_Rn01_00053485 predicted 859
3 SASI_Rn01_00053486 predicted 1548
4 SASI_Rn01_00053487 predicted 1558
5 SASI_Rn01_00053488 predicted 1399
6 SASI_Rn01_00053489 predicted 1296
7 SASI_Rn01_00053490 predicted 831
8 SASI_Rn02_00198915 predicted 1363
9 SASI_Rn01_00053492 predicted 1473
10 SASI_Rn02_00198916 predicted 865
11 SASI_Rn01_00053491 predicted 1530
12 SASI_Rn01_00053493 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322208 predicted 356
2 SASI_Rn02_00322209 predicted 443
3 SASI_Rn02_00322210 predicted 986
4 SASI_Rn02_00322211 predicted 758
5 SASI_Rn02_00322212 predicted 280
6 SASI_Rn02_00322213 predicted 881
7 SASI_Rn02_00322214 predicted 415
8 SASI_Rn02_00322215 predicted 952
9 SASI_Rn02_00322216 predicted 452
10 SASI_Rn02_00322217 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108902 predicted 388
2 SASI_Mm01_00108903 predicted 383
3 SASI_Mm01_00108905 predicted 410
4 SASI_Mm01_00108906 predicted 406
5 SASI_Mm01_00108907 predicted 292
6 SASI_Mm01_00108908 predicted 282
7 SASI_Mm01_00108909 predicted 424
8 SASI_Mm01_00108910 predicted 306
9 SASI_Mm01_00108911 predicted 436
10 SASI_Mm02_00339840 predicted 445
11 SASI_Mm01_00108904 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138948
CABP7 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-391s1c1
Sequence:CCGGCACTGACTTTGACACGGTCTTCTCGAGAAGACCGTGTCAAAGTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-244s1c1
Sequence:CCGGCCTGGGTTACATGCCCAACGACTCGAGTCGTTGGGCATGTAACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-454s1c1
Sequence:CCGGGCGGCTTCTCTATGACACCTTCTCGAGAAGGTGTCATAGAGAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-275s1c1
Sequence:CCGGGAGGTTATCATCCAGCGGCTACTCGAGTAGCCGCTGGATGATAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-487s1c1
Sequence:CCGGGTCCATGAAGGACATAGAGAACTCGAGTTCTCTATGTCCTTCATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-562s21c1
Sequence:CCGGGACGTGGAGACCTGTTCCAACCTCGAGGTTGGAACAGGTCTCCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-642s21c1
Sequence:CCGGCATCATCAGTGTCATGCTCATCTCGAGATGAGCATGACACTGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-211s21c1
Sequence:CCGGTCTAAGCAGGAGCTGGGAACACTCGAGTGTTCCCAGCTCCTGCTTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138948
CABP7 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-391s1c1
Sequence:CCGGCACTGACTTTGACACGGTCTTCTCGAGAAGACCGTGTCAAAGTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-244s1c1
Sequence:CCGGCCTGGGTTACATGCCCAACGACTCGAGTCGTTGGGCATGTAACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-454s1c1
Sequence:CCGGGCGGCTTCTCTATGACACCTTCTCGAGAAGGTGTCATAGAGAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-275s1c1
Sequence:CCGGGAGGTTATCATCCAGCGGCTACTCGAGTAGCCGCTGGATGATAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-487s1c1
Sequence:CCGGGTCCATGAAGGACATAGAGAACTCGAGTTCTCTATGTCCTTCATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-562s21c1
Sequence:CCGGGACGTGGAGACCTGTTCCAACCTCGAGGTTGGAACAGGTCTCCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-642s21c1
Sequence:CCGGCATCATCAGTGTCATGCTCATCTCGAGATGAGCATGACACTGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-211s21c1
Sequence:CCGGTCTAAGCAGGAGCTGGGAACACTCGAGTGTTCCCAGCTCCTGCTTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138948
CABP7 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-391s1c1
Sequence:CCGGCACTGACTTTGACACGGTCTTCTCGAGAAGACCGTGTCAAAGTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-244s1c1
Sequence:CCGGCCTGGGTTACATGCCCAACGACTCGAGTCGTTGGGCATGTAACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-454s1c1
Sequence:CCGGGCGGCTTCTCTATGACACCTTCTCGAGAAGGTGTCATAGAGAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-275s1c1
Sequence:CCGGGAGGTTATCATCCAGCGGCTACTCGAGTAGCCGCTGGATGATAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138948.2-487s1c1
Sequence:CCGGGTCCATGAAGGACATAGAGAACTCGAGTTCTCTATGTCCTTCATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-562s21c1
Sequence:CCGGGACGTGGAGACCTGTTCCAACCTCGAGGTTGGAACAGGTCTCCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-642s21c1
Sequence:CCGGCATCATCAGTGTCATGCTCATCTCGAGATGAGCATGACACTGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138948.3-211s21c1
Sequence:CCGGTCTAAGCAGGAGCTGGGAACACTCGAGTGTTCCCAGCTCCTGCTTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182527
CABP7 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-408s1c1
Sequence:CCGGGCACCGACTTTGATACTGTCTCTCGAGAGACAGTATCAAAGTCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-502s1c1
Sequence:CCGGCCTGTCCATGAAGGACATAGACTCGAGTCTATGTCCTTCATGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-331s1c1
Sequence:CCGGTCAAGTGGACTTTGAGGAGTTCTCGAGAACTCCTCAAAGTCCACTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-191s1c1
Sequence:CCGGGCCTTCAAGGTGTTTGACCGTCTCGAGACGGTCAAACACCTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-655s1c1
Sequence:CCGGCGCCTTCATCATCAGTGTCATCTCGAGATGACACTGATGATGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182527.2-699s21c1
Sequence:CCGGTGCGCAGTGGCATGAAGTAGACTCGAGTCTACTTCATGCCACTGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182527
CABP7 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-408s1c1
Sequence:CCGGGCACCGACTTTGATACTGTCTCTCGAGAGACAGTATCAAAGTCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-502s1c1
Sequence:CCGGCCTGTCCATGAAGGACATAGACTCGAGTCTATGTCCTTCATGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-331s1c1
Sequence:CCGGTCAAGTGGACTTTGAGGAGTTCTCGAGAACTCCTCAAAGTCCACTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-191s1c1
Sequence:CCGGGCCTTCAAGGTGTTTGACCGTCTCGAGACGGTCAAACACCTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-655s1c1
Sequence:CCGGCGCCTTCATCATCAGTGTCATCTCGAGATGACACTGATGATGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182527.2-699s21c1
Sequence:CCGGTGCGCAGTGGCATGAAGTAGACTCGAGTCTACTTCATGCCACTGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182527
CABP7 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-408s1c1
Sequence:CCGGGCACCGACTTTGATACTGTCTCTCGAGAGACAGTATCAAAGTCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-502s1c1
Sequence:CCGGCCTGTCCATGAAGGACATAGACTCGAGTCTATGTCCTTCATGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-331s1c1
Sequence:CCGGTCAAGTGGACTTTGAGGAGTTCTCGAGAACTCCTCAAAGTCCACTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-191s1c1
Sequence:CCGGGCCTTCAAGGTGTTTGACCGTCTCGAGACGGTCAAACACCTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182527.1-655s1c1
Sequence:CCGGCGCCTTCATCATCAGTGTCATCTCGAGATGACACTGATGATGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182527.2-699s21c1
Sequence:CCGGTGCGCAGTGGCATGAAGTAGACTCGAGTCTACTTCATGCCACTGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)