EMAIL THIS PAGE TO A FRIEND

CABS1

calcium-binding protein, spermatid-specific 1

77 Gene Product Result for
Synonyms: C4orf35 CLPH NYD-SP26
UniProtKB ID: Q96KC9, B2RCB5, Q86UE0, Q96M17
Gene ID:
Mouse(70977) calcium binding protein, spermatid specific 1
Rat(64029) calcium-binding protein, spermatid-specific 1
dog(475165) calcium-binding protein, spermatid-specific 1
cow(519098) calcium-binding protein, spermatid-specific 1
domestic cat(101085797) calcium-binding protein, spermatid-specific 1
sheep(101120833) calcium-binding protein, spermatid-specific 1
naked mole-rat(101699000) calcium-binding protein, spermatid-specific 1
domestic guinea pig(100732555) calcium-binding protein, spermatid-specific 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023371 MISSION® esiRNA esiRNA human C4orf35 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033122 Rosetta Predictions human pricing
NM_022263 Rosetta Predictions rat pricing
NM_027631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168062 predicted 1112
2 SASI_Hs01_00168063 predicted 803
3 SASI_Hs02_00360848 predicted 556
4 SASI_Hs01_00168066 predicted 1166
5 SASI_Hs01_00168067 predicted 1042
6 SASI_Hs01_00168068 predicted 275
7 SASI_Hs01_00168070 predicted 748
8 SASI_Hs02_00360849 predicted 1093
9 SASI_Hs01_00168071 predicted 1098
10 SASI_Hs02_00360850 predicted 512
11 SASI_Hs01_00168064 predicted 721
12 SASI_Hs01_00168065 predicted 1141
13 SASI_Hs01_00168069 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263065 predicted 883
2 SASI_Rn01_00100262 predicted 326
3 SASI_Rn01_00100263 predicted 843
4 SASI_Rn01_00100264 predicted 722
5 SASI_Rn01_00100265 predicted 336
6 SASI_Rn01_00100266 predicted 534
7 SASI_Rn01_00100267 predicted 719
8 SASI_Rn01_00100268 predicted 926
9 SASI_Rn01_00100269 predicted 259
10 SASI_Rn01_00100271 predicted 571
11 SASI_Rn01_00100270 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124429 predicted 742
2 SASI_Mm02_00332500 predicted 455
3 SASI_Mm01_00124431 predicted 735
4 SASI_Mm01_00124432 predicted 971
5 SASI_Mm01_00124433 predicted 274
6 SASI_Mm01_00124434 predicted 1184
7 SASI_Mm01_00124435 predicted 891
8 SASI_Mm01_00124436 predicted 611
9 SASI_Mm01_00124437 predicted 228
10 SASI_Mm01_00124438 predicted 454
11 SASI_Mm01_00124430 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033122
CABS1 MISSION shRNA Bacterial Glycerol Stock
calcium-binding protein, spermatid-specific 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033122.3-1254s21c1
Sequence:CCGGCCCGATGAGTTCATGATTTAACTCGAGTTAAATCATGAACTCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033122.3-641s21c1
Sequence:CCGGAGCTGATATGAGCAATTATAACTCGAGTTATAATTGCTCATATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-892s1c1
Sequence:CCGGGAAGATACTCTGCTAACTGATCTCGAGATCAGTTAGCAGAGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-1172s1c1
Sequence:CCGGCCTCCACAACTGAAACGGATACTCGAGTATCCGTTTCAGTTGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-136s1c1
Sequence:CCGGGCTGACAATGCTATTCCCAAACTCGAGTTTGGGAATAGCATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-677s1c1
Sequence:CCGGCCATTATTCCTGAGGCTGAAACTCGAGTTTCAGCCTCAGGAATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-384s1c1
Sequence:CCGGCGAACATTTCATGCCAGTGAACTCGAGTTCACTGGCATGAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033122.2-1330s1c1
Sequence:CCGGGAAATGAAAGAATGTGGGCATCTCGAGATGCCCACATTCTTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033122
CABS1 MISSION shRNA shRNA Plasmid DNA
calcium-binding protein, spermatid-specific 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033122.3-1254s21c1
Sequence:CCGGCCCGATGAGTTCATGATTTAACTCGAGTTAAATCATGAACTCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033122.3-641s21c1
Sequence:CCGGAGCTGATATGAGCAATTATAACTCGAGTTATAATTGCTCATATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-892s1c1
Sequence:CCGGGAAGATACTCTGCTAACTGATCTCGAGATCAGTTAGCAGAGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-1172s1c1
Sequence:CCGGCCTCCACAACTGAAACGGATACTCGAGTATCCGTTTCAGTTGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-136s1c1
Sequence:CCGGGCTGACAATGCTATTCCCAAACTCGAGTTTGGGAATAGCATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-677s1c1
Sequence:CCGGCCATTATTCCTGAGGCTGAAACTCGAGTTTCAGCCTCAGGAATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-384s1c1
Sequence:CCGGCGAACATTTCATGCCAGTGAACTCGAGTTCACTGGCATGAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033122.2-1330s1c1
Sequence:CCGGGAAATGAAAGAATGTGGGCATCTCGAGATGCCCACATTCTTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033122
CABS1 MISSION shRNA Lentiviral Transduction Particles
calcium-binding protein, spermatid-specific 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033122.3-1254s21c1
Sequence:CCGGCCCGATGAGTTCATGATTTAACTCGAGTTAAATCATGAACTCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033122.3-641s21c1
Sequence:CCGGAGCTGATATGAGCAATTATAACTCGAGTTATAATTGCTCATATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-892s1c1
Sequence:CCGGGAAGATACTCTGCTAACTGATCTCGAGATCAGTTAGCAGAGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-1172s1c1
Sequence:CCGGCCTCCACAACTGAAACGGATACTCGAGTATCCGTTTCAGTTGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-136s1c1
Sequence:CCGGGCTGACAATGCTATTCCCAAACTCGAGTTTGGGAATAGCATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-677s1c1
Sequence:CCGGCCATTATTCCTGAGGCTGAAACTCGAGTTTCAGCCTCAGGAATAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033122.2-384s1c1
Sequence:CCGGCGAACATTTCATGCCAGTGAACTCGAGTTCACTGGCATGAAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033122.2-1330s1c1
Sequence:CCGGGAAATGAAAGAATGTGGGCATCTCGAGATGCCCACATTCTTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027631
CABS1 MISSION shRNA Bacterial Glycerol Stock
calcium-binding protein, spermatid-specific 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.2-1198s1c1
Sequence:CCGGCAGACGATCTCATGATGTAAACTCGAGTTTACATCATGAGATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.2-737s1c1
Sequence:CCGGGAATGTAACTGAGATCAAATTCTCGAGAATTTGATCTCAGTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.1-561s1c1
Sequence:CCGGGCCTCTGGATTTCCAGATGAACTCGAGTTCATCTGGAAATCCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027631.1-1220s1c1
Sequence:CCGGCCAGTAACATAAGGGAAGCCACTCGAGTGGCTTCCCTTATGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-276s1c1
Sequence:CCGGGATATTGAAGGCTGTCTGAAACTCGAGTTTCAGACAGCCTTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027631.1-1282s1c1
Sequence:CCGGGTCTAAGAAGTTACTCAGCAACTCGAGTTGCTGAGTAACTTCTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.1-894s1c1
Sequence:CCGGGAATCGACTGATGGAGCTAATCTCGAGATTAGCTCCATCAGTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-153s1c1
Sequence:CCGGGAAACAACTATTACCTCGGAACTCGAGTTCCGAGGTAATAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-978s1c1
Sequence:CCGGGAATCGAGGTATGACTTTATTCTCGAGAATAAAGTCATACCTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027631
CABS1 MISSION shRNA shRNA Plasmid DNA
calcium-binding protein, spermatid-specific 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.2-1198s1c1
Sequence:CCGGCAGACGATCTCATGATGTAAACTCGAGTTTACATCATGAGATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.2-737s1c1
Sequence:CCGGGAATGTAACTGAGATCAAATTCTCGAGAATTTGATCTCAGTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.1-561s1c1
Sequence:CCGGGCCTCTGGATTTCCAGATGAACTCGAGTTCATCTGGAAATCCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027631.1-1220s1c1
Sequence:CCGGCCAGTAACATAAGGGAAGCCACTCGAGTGGCTTCCCTTATGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-276s1c1
Sequence:CCGGGATATTGAAGGCTGTCTGAAACTCGAGTTTCAGACAGCCTTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027631.1-1282s1c1
Sequence:CCGGGTCTAAGAAGTTACTCAGCAACTCGAGTTGCTGAGTAACTTCTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.1-894s1c1
Sequence:CCGGGAATCGACTGATGGAGCTAATCTCGAGATTAGCTCCATCAGTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-153s1c1
Sequence:CCGGGAAACAACTATTACCTCGGAACTCGAGTTCCGAGGTAATAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-978s1c1
Sequence:CCGGGAATCGAGGTATGACTTTATTCTCGAGAATAAAGTCATACCTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027631
CABS1 MISSION shRNA Lentiviral Transduction Particles
calcium-binding protein, spermatid-specific 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.2-1198s1c1
Sequence:CCGGCAGACGATCTCATGATGTAAACTCGAGTTTACATCATGAGATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.2-737s1c1
Sequence:CCGGGAATGTAACTGAGATCAAATTCTCGAGAATTTGATCTCAGTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.1-561s1c1
Sequence:CCGGGCCTCTGGATTTCCAGATGAACTCGAGTTCATCTGGAAATCCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027631.1-1220s1c1
Sequence:CCGGCCAGTAACATAAGGGAAGCCACTCGAGTGGCTTCCCTTATGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-276s1c1
Sequence:CCGGGATATTGAAGGCTGTCTGAAACTCGAGTTTCAGACAGCCTTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027631.1-1282s1c1
Sequence:CCGGGTCTAAGAAGTTACTCAGCAACTCGAGTTGCTGAGTAACTTCTTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027631.1-894s1c1
Sequence:CCGGGAATCGACTGATGGAGCTAATCTCGAGATTAGCTCCATCAGTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-153s1c1
Sequence:CCGGGAAACAACTATTACCTCGGAACTCGAGTTCCGAGGTAATAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027631.1-978s1c1
Sequence:CCGGGAATCGAGGTATGACTTTATTCTCGAGAATAAAGTCATACCTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks