EMAIL THIS PAGE TO A FRIEND

CACFD1

calcium channel flower domain containing 1

54 Gene Product Result for
Synonyms: C9orf7 D9S2135 FLOWER
UniProtKB ID: Q9UGQ2, B7Z3T8, B7Z5E1, F5GXX4, Q5SXD4, Q8NBM6
Gene ID:
Mouse(381356) calcium channel flower domain containing 1
Rat(296599) calcium channel flower domain containing 1
Zebrafish(324371) calcium channel flower domain containing 1
domestic cat(101083980) calcium channel flower domain containing 1
cow(512024) calcium channel flower domain containing 1
dog(491273) calcium channel flower domain containing 1
sheep(101111957) calcium channel flower domain containing 1
naked mole-rat(101713938) calcium channel flower domain containing 1
domestic guinea pig(100716093) calcium channel flower domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066691 MISSION® esiRNA esiRNA targeting mouse 5930434B04Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017586 Rosetta Predictions human pricing
NM_001106561 Rosetta Predictions rat pricing
NM_029862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350251 predicted 292
2 SASI_Hs01_00142014 predicted 1060
3 SASI_Hs01_00142015 predicted 285
4 SASI_Hs01_00142016 predicted 488
5 SASI_Hs02_00350252 predicted 672
6 SASI_Hs01_00142019 predicted 243
7 SASI_Hs01_00142020 predicted 831
8 SASI_Hs01_00142022 predicted 203
9 SASI_Hs01_00142023 predicted 464
10 SASI_Hs02_00350253 predicted 309
11 SASI_Hs01_00142017 predicted 680
12 SASI_Hs01_00142018 predicted 1063
13 SASI_Hs01_00142021 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220168 predicted 1124
2 SASI_Rn02_00220169 predicted 1337
3 SASI_Rn02_00220170 predicted 1424
4 SASI_Rn02_00220171 predicted 1568
5 SASI_Rn02_00220172 predicted 1130
6 SASI_Rn02_00220173 predicted 1150
7 SASI_Rn02_00220174 predicted 1053
8 SASI_Rn02_00220175 predicted 1481
9 SASI_Rn02_00220176 predicted 1348
10 SASI_Rn02_00220177 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336091 predicted 776
2 SASI_Mm02_00336092 predicted 737
3 SASI_Mm02_00336093 predicted 941
4 SASI_Mm02_00336094 predicted 616
5 SASI_Mm02_00336095 predicted 772
6 SASI_Mm02_00336096 predicted 956
7 SASI_Mm01_00097526 predicted 367
8 SASI_Mm02_00336097 predicted 875
9 SASI_Mm02_00336098 predicted 320
10 SASI_Mm02_00336099 predicted 917
11 SASI_Mm01_00097522 predicted 626
12 SASI_Mm01_00097523 predicted 927
13 SASI_Mm01_00097524 predicted 280
14 SASI_Mm01_00097525 predicted 335
15 SASI_Mm01_00097527 predicted 885
16 SASI_Mm01_00097528 predicted 658
17 SASI_Mm01_00097529 predicted 882
18 SASI_Mm01_00097530 predicted 749
19 SASI_Mm01_00097531 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017586
CACFD1 MISSION shRNA Bacterial Glycerol Stock
calcium channel flower domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017586.2-886s21c1
Sequence:CCGGTGCAGATCTCACACCACAGACCTCGAGGTCTGTGGTGTGAGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017586.2-537s21c1
Sequence:CCGGTGCGATCTCCTATGCCAGGATCTCGAGATCCTGGCATAGGAGATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017586.2-258s21c1
Sequence:CCGGCATCCACCCTCTGAACATTGCCTCGAGGCAATGTTCAGAGGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-244s1c1
Sequence:CCGGGTGGATGATCATGAATGCCTTCTCGAGAAGGCATTCATGATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-256s1c1
Sequence:CCGGGAATGCCTTCATCTTGTTGCTCTCGAGAGCAACAAGATGAAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-298s1c1
Sequence:CCGGCCAGTTCATCGAGTTTGCAAACTCGAGTTTGCAAACTCGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-247s1c1
Sequence:CCGGGATGATCATGAATGCCTTCATCTCGAGATGAAGGCATTCATGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017586.1-1802s1c1
Sequence:CCGGGTCTTGCTAAGTGAACTGTTTCTCGAGAAACAGTTCACTTAGCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017586
CACFD1 MISSION shRNA shRNA Plasmid DNA
calcium channel flower domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017586.2-886s21c1
Sequence:CCGGTGCAGATCTCACACCACAGACCTCGAGGTCTGTGGTGTGAGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017586.2-537s21c1
Sequence:CCGGTGCGATCTCCTATGCCAGGATCTCGAGATCCTGGCATAGGAGATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017586.2-258s21c1
Sequence:CCGGCATCCACCCTCTGAACATTGCCTCGAGGCAATGTTCAGAGGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-244s1c1
Sequence:CCGGGTGGATGATCATGAATGCCTTCTCGAGAAGGCATTCATGATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-256s1c1
Sequence:CCGGGAATGCCTTCATCTTGTTGCTCTCGAGAGCAACAAGATGAAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-298s1c1
Sequence:CCGGCCAGTTCATCGAGTTTGCAAACTCGAGTTTGCAAACTCGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-247s1c1
Sequence:CCGGGATGATCATGAATGCCTTCATCTCGAGATGAAGGCATTCATGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017586.1-1802s1c1
Sequence:CCGGGTCTTGCTAAGTGAACTGTTTCTCGAGAAACAGTTCACTTAGCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017586
CACFD1 MISSION shRNA Lentiviral Transduction Particles
calcium channel flower domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017586.2-886s21c1
Sequence:CCGGTGCAGATCTCACACCACAGACCTCGAGGTCTGTGGTGTGAGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017586.2-537s21c1
Sequence:CCGGTGCGATCTCCTATGCCAGGATCTCGAGATCCTGGCATAGGAGATCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017586.2-258s21c1
Sequence:CCGGCATCCACCCTCTGAACATTGCCTCGAGGCAATGTTCAGAGGGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-244s1c1
Sequence:CCGGGTGGATGATCATGAATGCCTTCTCGAGAAGGCATTCATGATCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-256s1c1
Sequence:CCGGGAATGCCTTCATCTTGTTGCTCTCGAGAGCAACAAGATGAAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-298s1c1
Sequence:CCGGCCAGTTCATCGAGTTTGCAAACTCGAGTTTGCAAACTCGATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017586.1-247s1c1
Sequence:CCGGGATGATCATGAATGCCTTCATCTCGAGATGAAGGCATTCATGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017586.1-1802s1c1
Sequence:CCGGGTCTTGCTAAGTGAACTGTTTCTCGAGAAACAGTTCACTTAGCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029862
VALIDATED
CACFD1 MISSION shRNA Bacterial Glycerol Stock
calcium channel flower domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-199s1c1
Sequence:CCGGTGGCGTGTGGATGATCATGAACTCGAGTTCATGATCATCCACACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-158s1c1
Sequence:CCGGCTCTTCAACTGCGTCACTATCCTCGAGGATAGTGACGCAGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029862.3-72s1c1
Sequence:CCGGCACAGGAAGAGGGCATGACTTCTCGAGAAGTCATGCCCTCTTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029862.3-737s1c1
Sequence:CCGGACCGGCATCAGTGGCTTATTACTCGAGTAATAAGCCACTGATGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-255s1c1
Sequence:CCGGGCTGCCAGTTTGTGGAGTTTGCTCGAGCAAACTCCACAAACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029862
VALIDATED
CACFD1 MISSION shRNA shRNA Plasmid DNA
calcium channel flower domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-199s1c1
Sequence:CCGGTGGCGTGTGGATGATCATGAACTCGAGTTCATGATCATCCACACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-158s1c1
Sequence:CCGGCTCTTCAACTGCGTCACTATCCTCGAGGATAGTGACGCAGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029862.3-72s1c1
Sequence:CCGGCACAGGAAGAGGGCATGACTTCTCGAGAAGTCATGCCCTCTTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029862.3-737s1c1
Sequence:CCGGACCGGCATCAGTGGCTTATTACTCGAGTAATAAGCCACTGATGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-255s1c1
Sequence:CCGGGCTGCCAGTTTGTGGAGTTTGCTCGAGCAAACTCCACAAACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029862
VALIDATED
CACFD1 MISSION shRNA Lentiviral Transduction Particles
calcium channel flower domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-199s1c1
Sequence:CCGGTGGCGTGTGGATGATCATGAACTCGAGTTCATGATCATCCACACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-158s1c1
Sequence:CCGGCTCTTCAACTGCGTCACTATCCTCGAGGATAGTGACGCAGTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029862.3-72s1c1
Sequence:CCGGCACAGGAAGAGGGCATGACTTCTCGAGAAGTCATGCCCTCTTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029862.3-737s1c1
Sequence:CCGGACCGGCATCAGTGGCTTATTACTCGAGTAATAAGCCACTGATGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_029862.3-255s1c1
Sequence:CCGGGCTGCCAGTTTGTGGAGTTTGCTCGAGCAAACTCCACAAACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks