EMAIL THIS PAGE TO A FRIEND

CACHD1

cache domain containing 1

104 Gene Product Result for
Synonyms: RP4-655E10.1
Gene ID:
Mouse(320508) cache domain containing 1
Rat(298267) cache domain containing 1
sheep(101110191) cache domain containing 1
Domestic Rabbit(100356570) cache domain containing 1
domestic guinea pig(100727453) cache domain containing 1
naked mole-rat(101719323) cache domain containing 1
Zebrafish(794807) cache domain containing 1
cow(536020) cache domain containing 1
Horse(100054054) cache domain containing 1
domestic cat(101101489) cache domain containing 1
dog(479541) cache domain containing 1
chicken(424693) cache domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020925 Rosetta Predictions human pricing
XM_001056642 Rosetta Predictions rat pricing
XM_233227 Rosetta Predictions rat pricing
NM_198037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354310 predicted 772
2 SASI_Hs02_00354311 predicted 557
3 SASI_Hs01_00030715 predicted 1436
4 SASI_Hs01_00030717 predicted 2239
5 SASI_Hs01_00030718 predicted 1373
6 SASI_Hs02_00354312 predicted 393
7 SASI_Hs01_00030719 predicted 3724
8 SASI_Hs02_00354313 predicted 420
9 SASI_Hs01_00030720 predicted 3443
10 SASI_Hs02_00354314 predicted 571
11 SASI_Hs01_00030712 predicted 1689
12 SASI_Hs01_00030713 predicted 3957
13 SASI_Hs01_00030714 predicted 1185
14 SASI_Hs01_00030716 predicted 2009
15 SASI_Hs01_00030721 predicted 2695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283911 predicted 2673
2 SASI_Rn02_00283912 predicted 2956
3 SASI_Rn02_00283913 predicted 3891
4 SASI_Rn02_00283914 predicted 1105
5 SASI_Rn02_00283915 predicted 2315
6 SASI_Rn02_00283916 predicted 1601
7 SASI_Rn02_00283917 predicted 2844
8 SASI_Rn02_00283918 predicted 1898
9 SASI_Rn02_00283919 predicted 2528
10 SASI_Rn02_00283920 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387531 predicted 2668
2 SASI_Rn02_00387532 predicted 2963
3 SASI_Rn02_00387533 predicted 3891
4 SASI_Rn02_00387534 predicted 1468
5 SASI_Rn02_00387535 predicted 2311
6 SASI_Rn02_00387536 predicted 1598
7 SASI_Rn02_00387537 predicted 2844
8 SASI_Rn02_00387538 predicted 3540
9 SASI_Rn02_00387539 predicted 1899
10 SASI_Rn02_00387540 predicted 2529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075733 predicted 2666
2 SASI_Mm01_00075734 predicted 2962
3 SASI_Mm01_00075735 predicted 3885
4 SASI_Mm02_00350790 predicted 1269
5 SASI_Mm01_00075736 predicted 1895
6 SASI_Mm01_00075737 predicted 1096
7 SASI_Mm01_00075738 predicted 2845
8 SASI_Mm01_00075739 predicted 3359
9 SASI_Mm01_00075740 predicted 1609
10 SASI_Mm01_00075742 predicted 1093
11 SASI_Mm01_00075741 predicted 2533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020925
CACHD1 MISSION shRNA Bacterial Glycerol Stock
cache domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-3648s1c1
Sequence:CCGGCGTATGTCCAACCTGGAGAATCTCGAGATTCTCCAGGTTGGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-3631s1c1
Sequence:CCGGCCCAAGAAATGTCAGTGCGTACTCGAGTACGCACTGACATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020925.1-4879s1c1
Sequence:CCGGGCAGAGGAATTTAAGAGGTTTCTCGAGAAACCTCTTAAATTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-1352s1c1
Sequence:CCGGCTCTGTAATGATTCTCACCTACTCGAGTAGGTGAGAATCATTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-2421s1c1
Sequence:CCGGCGTTACATAGCAACACCCAATCTCGAGATTGGGTGTTGCTATGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-2243s21c1
Sequence:CCGGTAGCTAATCCAGGGTTGATTTCTCGAGAAATCAACCCTGGATTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-3436s21c1
Sequence:CCGGATCAGCAACACTCGGTTTATACTCGAGTATAAACCGAGTGTTGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-781s21c1
Sequence:CCGGTCACTAGACCAGTGCTATAAGCTCGAGCTTATAGCACTGGTCTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020925
CACHD1 MISSION shRNA shRNA Plasmid DNA
cache domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-3648s1c1
Sequence:CCGGCGTATGTCCAACCTGGAGAATCTCGAGATTCTCCAGGTTGGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-3631s1c1
Sequence:CCGGCCCAAGAAATGTCAGTGCGTACTCGAGTACGCACTGACATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020925.1-4879s1c1
Sequence:CCGGGCAGAGGAATTTAAGAGGTTTCTCGAGAAACCTCTTAAATTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-1352s1c1
Sequence:CCGGCTCTGTAATGATTCTCACCTACTCGAGTAGGTGAGAATCATTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-2421s1c1
Sequence:CCGGCGTTACATAGCAACACCCAATCTCGAGATTGGGTGTTGCTATGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-2243s21c1
Sequence:CCGGTAGCTAATCCAGGGTTGATTTCTCGAGAAATCAACCCTGGATTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-3436s21c1
Sequence:CCGGATCAGCAACACTCGGTTTATACTCGAGTATAAACCGAGTGTTGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-781s21c1
Sequence:CCGGTCACTAGACCAGTGCTATAAGCTCGAGCTTATAGCACTGGTCTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020925
CACHD1 MISSION shRNA Lentiviral Transduction Particles
cache domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-3648s1c1
Sequence:CCGGCGTATGTCCAACCTGGAGAATCTCGAGATTCTCCAGGTTGGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-3631s1c1
Sequence:CCGGCCCAAGAAATGTCAGTGCGTACTCGAGTACGCACTGACATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020925.1-4879s1c1
Sequence:CCGGGCAGAGGAATTTAAGAGGTTTCTCGAGAAACCTCTTAAATTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-1352s1c1
Sequence:CCGGCTCTGTAATGATTCTCACCTACTCGAGTAGGTGAGAATCATTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020925.1-2421s1c1
Sequence:CCGGCGTTACATAGCAACACCCAATCTCGAGATTGGGTGTTGCTATGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-2243s21c1
Sequence:CCGGTAGCTAATCCAGGGTTGATTTCTCGAGAAATCAACCCTGGATTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-3436s21c1
Sequence:CCGGATCAGCAACACTCGGTTTATACTCGAGTATAAACCGAGTGTTGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020925.2-781s21c1
Sequence:CCGGTCACTAGACCAGTGCTATAAGCTCGAGCTTATAGCACTGGTCTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198037
VALIDATED
CACHD1 MISSION shRNA Bacterial Glycerol Stock
cache domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198037.1-2682s1c1
Sequence:CCGGCCGTTACATAGCAACACCCAACTCGAGTTGGGTGTTGCTATGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198037.1-2317s1c1
Sequence:CCGGCCGGAAATACCCGTCAAACAACTCGAGTTGTTTGACGGGTATTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198037.1-4733s1c1
Sequence:CCGGGCTCTAAACGATGCATCTCAACTCGAGTTGAGATGCATCGTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198037.1-4490s1c1
Sequence:CCGGCCTGATGAACTGACCTGACATCTCGAGATGTCAGGTCAGTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1321s21c1
Sequence:CCGGTCGTTGGACCAGTGCTATAAGCTCGAGCTTATAGCACTGGTCCAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1968s21c1
Sequence:CCGGCCTTGAAGATGTGACATATTACTCGAGTAATATGTCACATCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1038s21c1
Sequence:CCGGTGGAATCAAGTGGCAATATTTCTCGAGAAATATTGCCACTTGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-2306s21c1
Sequence:CCGGTGGTGATACAACCGGAAATACCTCGAGGTATTTCCGGTTGTATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198037.1-4720s21c1
Sequence:CCGGGAGCTCACCTTAGGCTCTAAACTCGAGTTTAGAGCCTAAGGTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198037
VALIDATED
CACHD1 MISSION shRNA shRNA Plasmid DNA
cache domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198037.1-2682s1c1
Sequence:CCGGCCGTTACATAGCAACACCCAACTCGAGTTGGGTGTTGCTATGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198037.1-2317s1c1
Sequence:CCGGCCGGAAATACCCGTCAAACAACTCGAGTTGTTTGACGGGTATTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198037.1-4733s1c1
Sequence:CCGGGCTCTAAACGATGCATCTCAACTCGAGTTGAGATGCATCGTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198037.1-4490s1c1
Sequence:CCGGCCTGATGAACTGACCTGACATCTCGAGATGTCAGGTCAGTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1321s21c1
Sequence:CCGGTCGTTGGACCAGTGCTATAAGCTCGAGCTTATAGCACTGGTCCAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1968s21c1
Sequence:CCGGCCTTGAAGATGTGACATATTACTCGAGTAATATGTCACATCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1038s21c1
Sequence:CCGGTGGAATCAAGTGGCAATATTTCTCGAGAAATATTGCCACTTGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-2306s21c1
Sequence:CCGGTGGTGATACAACCGGAAATACCTCGAGGTATTTCCGGTTGTATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198037.1-4720s21c1
Sequence:CCGGGAGCTCACCTTAGGCTCTAAACTCGAGTTTAGAGCCTAAGGTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198037
VALIDATED
CACHD1 MISSION shRNA Lentiviral Transduction Particles
cache domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198037.1-2682s1c1
Sequence:CCGGCCGTTACATAGCAACACCCAACTCGAGTTGGGTGTTGCTATGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198037.1-2317s1c1
Sequence:CCGGCCGGAAATACCCGTCAAACAACTCGAGTTGTTTGACGGGTATTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198037.1-4733s1c1
Sequence:CCGGGCTCTAAACGATGCATCTCAACTCGAGTTGAGATGCATCGTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198037.1-4490s1c1
Sequence:CCGGCCTGATGAACTGACCTGACATCTCGAGATGTCAGGTCAGTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1321s21c1
Sequence:CCGGTCGTTGGACCAGTGCTATAAGCTCGAGCTTATAGCACTGGTCCAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1968s21c1
Sequence:CCGGCCTTGAAGATGTGACATATTACTCGAGTAATATGTCACATCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-1038s21c1
Sequence:CCGGTGGAATCAAGTGGCAATATTTCTCGAGAAATATTGCCACTTGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198037.1-2306s21c1
Sequence:CCGGTGGTGATACAACCGGAAATACCTCGAGGTATTTCCGGTTGTATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198037.1-4720s21c1
Sequence:CCGGGAGCTCACCTTAGGCTCTAAACTCGAGTTTAGAGCCTAAGGTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks