EMAIL THIS PAGE TO A FRIEND

CACNA1A

calcium channel, voltage-dependent, P/Q type, alpha 1A subunit

99 Gene Product Result for
Synonyms: APCA BI CACNL1A4 CAV2.1 EA2 FHM HPCA MHP MHP1 SCA6
Gene ID:
Human(773) Summary: Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-16 to 21-28 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Mar 2010]
Mouse(12286) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Rat(25398) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
dog(100686650) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
dog(100126772) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
cow(282648) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
domestic cat(101094827) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
naked mole-rat(101725815) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
domestic guinea pig(100726277) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
sheep(101120920) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Domestic Rabbit(100009265) calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
C5270 Cinnarizine powder human pricing
A6719 ω-Agatoxin IVA ≥90% (HPLC) human, mouse, rat pricing
A2202 ω-Agatoxin TK ~98% (HPLC), powder human, mouse, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
G154 Gabapentin solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000068 Rosetta Predictions human pricing
NM_001127221 Rosetta Predictions human pricing
NM_001127222 Rosetta Predictions human pricing
NM_023035 Rosetta Predictions human pricing
NM_012918 Rosetta Predictions rat pricing
NM_007578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112614 predicted 4291
2 SASI_Hs01_00112615 predicted 4352
3 SASI_Hs01_00112616 predicted 1860
4 SASI_Hs01_00112617 predicted 4111
5 SASI_Hs01_00112618 predicted 5361
6 SASI_Hs01_00112619 predicted 1280
7 SASI_Hs01_00112620 predicted 4537
8 SASI_Hs01_00112621 predicted 4517
9 SASI_Hs01_00112622 predicted 6071
10 SASI_Hs01_00112623 predicted 5462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328867 predicted 4240
2 SASI_Hs02_00328868 predicted 4302
3 SASI_Hs02_00328869 predicted 1816
4 SASI_Hs02_00328870 predicted 4062
5 SASI_Hs02_00328871 predicted 5309
6 SASI_Hs02_00328872 predicted 1228
7 SASI_Hs02_00328873 predicted 445
8 SASI_Hs02_00328874 predicted 433
9 SASI_Hs02_00328875 predicted 4488
10 SASI_Hs02_00328876 predicted 4469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328877 predicted 4236
2 SASI_Hs02_00328878 predicted 4296
3 SASI_Hs02_00328879 predicted 1813
4 SASI_Hs02_00328880 predicted 4058
5 SASI_Hs02_00328881 predicted 5309
6 SASI_Hs02_00328882 predicted 1228
7 SASI_Hs02_00328883 predicted 447
8 SASI_Hs02_00328884 predicted 430
9 SASI_Hs02_00328885 predicted 4487
10 SASI_Hs02_00328886 predicted 4471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068495 predicted 4297
2 SASI_Hs01_00068496 predicted 4353
3 SASI_Hs01_00068497 predicted 1867
4 SASI_Hs01_00068498 predicted 4112
5 SASI_Hs01_00068499 predicted 5357
6 SASI_Hs01_00068500 predicted 1287
7 SASI_Hs01_00068501 predicted 4533
8 SASI_Hs01_00068502 predicted 4523
9 SASI_Hs01_00068503 predicted 6071
10 SASI_Hs01_00068504 predicted 5455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260454 predicted 6060
2 SASI_Rn01_00080702 predicted 1583
3 SASI_Rn01_00080703 predicted 4105
4 SASI_Rn01_00080704 predicted 1429
5 SASI_Rn02_00260455 predicted 2014
6 SASI_Rn01_00080705 predicted 5517
7 SASI_Rn01_00080706 predicted 4929
8 SASI_Rn01_00080707 predicted 564
9 SASI_Rn01_00080708 predicted 1562
10 SASI_Rn01_00080709 predicted 5396
11 SASI_Rn01_00080701 predicted 730
12 SASI_Rn01_00080710 predicted 5455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196117 predicted 1862
2 SASI_Mm02_00311965 predicted 1710
3 SASI_Mm02_00311966 predicted 5734
4 SASI_Mm01_00196118 predicted 693
5 SASI_Mm01_00196119 predicted 4381
6 SASI_Mm01_00196120 predicted 4863
7 SASI_Mm02_00311967 predicted 4270
8 SASI_Mm01_00196123 predicted 1837
9 SASI_Mm01_00196124 predicted 5684
10 SASI_Mm01_00196125 predicted 5726
11 SASI_Mm01_00196121 predicted 5789
12 SASI_Mm01_00196122 predicted 2293
13 SASI_Mm01_00196126 predicted 1707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127222
CACNA1A MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000430744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-2295s21c1
Sequence:CCGGATGGTGTTCTCCATCTATTTCCTCGAGGAAATAGATGGAGAACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-4159s21c1
Sequence:CCGGTCCGTGACCTCTGGAATATTCCTCGAGGAATATTCCAGAGGTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-4054s21c1
Sequence:CCGGACAACGTGCTGCGATACTTTGCTCGAGCAAAGTATCGCAGCACGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127222
CACNA1A MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000430744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-2295s21c1
Sequence:CCGGATGGTGTTCTCCATCTATTTCCTCGAGGAAATAGATGGAGAACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-4159s21c1
Sequence:CCGGTCCGTGACCTCTGGAATATTCCTCGAGGAATATTCCAGAGGTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-4054s21c1
Sequence:CCGGACAACGTGCTGCGATACTTTGCTCGAGCAAAGTATCGCAGCACGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127222
CACNA1A MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000430744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-2295s21c1
Sequence:CCGGATGGTGTTCTCCATCTATTTCCTCGAGGAAATAGATGGAGAACACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-4159s21c1
Sequence:CCGGTCCGTGACCTCTGGAATATTCCTCGAGGAATATTCCAGAGGTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127222.1-4054s21c1
Sequence:CCGGACAACGTGCTGCGATACTTTGCTCGAGCAAAGTATCGCAGCACGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007578
CACNA1A MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-3526s1c1
Sequence:CCGGCGCAACAATGTGCTGCGATATCTCGAGATATCGCAGCACATTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-4374s1c1
Sequence:CCGGCCAGTATCGAATGTGGCAGTTCTCGAGAACTGCCACATTCGATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-1828s1c1
Sequence:CCGGGCAGCAATAATGACTGTGTTTCTCGAGAAACACAGTCATTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-269s1c1
Sequence:CCGGCGGAACCATACTTCATTGGAACTCGAGTTCCAATGAAGTATGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-6112s1c1
Sequence:CCGGCGACTGGATGACTACTCACTACTCGAGTAGTGAGTAGTCATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007578
CACNA1A MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-3526s1c1
Sequence:CCGGCGCAACAATGTGCTGCGATATCTCGAGATATCGCAGCACATTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-4374s1c1
Sequence:CCGGCCAGTATCGAATGTGGCAGTTCTCGAGAACTGCCACATTCGATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-1828s1c1
Sequence:CCGGGCAGCAATAATGACTGTGTTTCTCGAGAAACACAGTCATTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-269s1c1
Sequence:CCGGCGGAACCATACTTCATTGGAACTCGAGTTCCAATGAAGTATGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-6112s1c1
Sequence:CCGGCGACTGGATGACTACTCACTACTCGAGTAGTGAGTAGTCATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007578
CACNA1A MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-3526s1c1
Sequence:CCGGCGCAACAATGTGCTGCGATATCTCGAGATATCGCAGCACATTGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-4374s1c1
Sequence:CCGGCCAGTATCGAATGTGGCAGTTCTCGAGAACTGCCACATTCGATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-1828s1c1
Sequence:CCGGGCAGCAATAATGACTGTGTTTCTCGAGAAACACAGTCATTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-269s1c1
Sequence:CCGGCGGAACCATACTTCATTGGAACTCGAGTTCCAATGAAGTATGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007578.1-6112s1c1
Sequence:CCGGCGACTGGATGACTACTCACTACTCGAGTAGTGAGTAGTCATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000068
CACNA1A MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000068.2-7092s1c1
Sequence:CCGGCCTCAACATCTGGTACCAGCACTCGAGTGCTGGTACCAGATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-5955s1c1
Sequence:CCGGCCACTTCAATTCCACCCTCATCTCGAGATGAGGGTGGAATTGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-2033s1c1
Sequence:CCGGCCCTCAGGTTATTGCGTATTTCTCGAGAAATACGCAATAACCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-4582s1c1
Sequence:CCGGCGGGAGTGGAAGAAGTATGAACTCGAGTTCATACTTCTTCCACTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-2248s1c1
Sequence:CCGGGCAGCAATAATGACGGTGTTTCTCGAGAAACACCGTCATTATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000068
CACNA1A MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000068.2-7092s1c1
Sequence:CCGGCCTCAACATCTGGTACCAGCACTCGAGTGCTGGTACCAGATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-5955s1c1
Sequence:CCGGCCACTTCAATTCCACCCTCATCTCGAGATGAGGGTGGAATTGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-2033s1c1
Sequence:CCGGCCCTCAGGTTATTGCGTATTTCTCGAGAAATACGCAATAACCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-4582s1c1
Sequence:CCGGCGGGAGTGGAAGAAGTATGAACTCGAGTTCATACTTCTTCCACTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-2248s1c1
Sequence:CCGGGCAGCAATAATGACGGTGTTTCTCGAGAAACACCGTCATTATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000068
CACNA1A MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000068.2-7092s1c1
Sequence:CCGGCCTCAACATCTGGTACCAGCACTCGAGTGCTGGTACCAGATGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-5955s1c1
Sequence:CCGGCCACTTCAATTCCACCCTCATCTCGAGATGAGGGTGGAATTGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-2033s1c1
Sequence:CCGGCCCTCAGGTTATTGCGTATTTCTCGAGAAATACGCAATAACCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-4582s1c1
Sequence:CCGGCGGGAGTGGAAGAAGTATGAACTCGAGTTCATACTTCTTCCACTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000068.2-2248s1c1
Sequence:CCGGGCAGCAATAATGACGGTGTTTCTCGAGAAACACCGTCATTATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks