EMAIL THIS PAGE TO A FRIEND

CACNA1B

calcium channel, voltage-dependent, N type, alpha 1B subunit

81 Gene Product Result for
Synonyms: BIII CACNL1A5 CACNN Cav2.2
UniProtKB ID: Q00975, B1AQK5
Gene ID:
Human(774) Summary: The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(12287) calcium channel, voltage-dependent, N type, alpha 1B subunit
Rat(257648) calcium channel, voltage-dependent, N type, alpha 1B subunit
chicken(374169) calcium channel, voltage-dependent, N type, alpha 1B subunit
cow(282410) calcium channel, voltage-dependent, N type, alpha 1B subunit
domestic cat(101087362) calcium channel, voltage-dependent, N type, alpha 1B subunit
dog(480660) calcium channel, voltage-dependent, N type, alpha 1B subunit
Domestic Rabbit(100008979) calcium channel, voltage-dependent, N type, alpha 1B subunit
domestic guinea pig(100735203) calcium channel, voltage-dependent, N type, alpha 1B subunit
naked mole-rat(101697609) calcium channel, voltage-dependent, N type, alpha 1B subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
C9915 ω-Conotoxin GVIA ≥97% (HPLC) human, mouse, rat pricing
C1182 ω-Conotoxin MVIIA ≥95% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000718 Rosetta Predictions human pricing
NM_147141 Rosetta Predictions rat pricing
XM_579676 Rosetta Predictions rat pricing
NM_001042528 Rosetta Predictions mouse pricing
NM_007579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203941 predicted 5045
2 SASI_Hs02_00303133 predicted 5713
3 SASI_Hs01_00203942 predicted 1664
4 SASI_Hs01_00203943 predicted 5434
5 SASI_Hs01_00203944 predicted 3776
6 SASI_Hs01_00203945 predicted 4174
7 SASI_Hs01_00203946 predicted 6663
8 SASI_Hs01_00203947 predicted 2325
9 SASI_Hs01_00203948 predicted 3590
10 SASI_Hs02_00303134 predicted 4771
11 SASI_Hs01_00203949 predicted 5496
12 SASI_Hs01_00203950 predicted 5580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034135 predicted 1534
2 SASI_Rn01_00034136 predicted 802
3 SASI_Rn02_00268849 predicted 1516
4 SASI_Rn01_00034137 predicted 4979
5 SASI_Rn01_00034138 predicted 524
6 SASI_Rn01_00034139 predicted 5641
7 SASI_Rn01_00034141 predicted 4382
8 SASI_Rn01_00034142 predicted 5215
9 SASI_Rn02_00268850 predicted 483
10 SASI_Rn01_00034143 predicted 3250
11 SASI_Rn01_00034140 predicted 2279
12 SASI_Rn01_00034144 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189475 predicted 1534
2 SASI_Rn01_00189476 predicted 5318
3 SASI_Rn01_00189477 predicted 2002
4 SASI_Rn01_00189478 predicted 2274
5 SASI_Rn01_00189479 predicted 4388
6 SASI_Rn01_00189480 predicted 5455
7 SASI_Rn01_00189481 predicted 5221
8 SASI_Rn01_00189482 predicted 4472
9 SASI_Rn01_00189483 predicted 3537
10 SASI_Rn01_00189484 predicted 3258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290545 predicted 4871
2 SASI_Mm02_00290546 predicted 1399
3 SASI_Mm02_00290547 predicted 434
4 SASI_Mm02_00290548 predicted 1252
5 SASI_Mm02_00290549 predicted 4276
6 SASI_Mm02_00290550 predicted 6715
7 SASI_Mm02_00290551 predicted 4369
8 SASI_Mm02_00290552 predicted 1265
9 SASI_Mm02_00290553 predicted 3417
10 SASI_Mm02_00290554 predicted 4203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311968 predicted 4971
2 SASI_Mm01_00154268 predicted 1505
3 SASI_Mm01_00154272 predicted 532
4 SASI_Mm01_00154269 predicted 1362
5 SASI_Mm01_00154271 predicted 4368
6 SASI_Mm01_00154274 predicted 6705
7 SASI_Mm01_00154276 predicted 4455
8 SASI_Mm02_00311969 predicted 1368
9 SASI_Mm02_00311970 predicted 3517
10 SASI_Mm02_00311971 predicted 4292
11 SASI_Mm01_00154267 predicted 836
12 SASI_Mm01_00154270 predicted 4986
13 SASI_Mm01_00154273 predicted 5540
14 SASI_Mm01_00154275 predicted 4972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000718
CACNA1B MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, N type, alpha 1B subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-1403s1c1
Sequence:CCGGGCCACCAAGAAGAGCAGAAATCTCGAGATTTCTGCTCTTCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-5497s1c1
Sequence:CCGGCGAGGACATGACTGTTCACTTCTCGAGAAGTGAACAGTCATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-5371s1c1
Sequence:CCGGGCGCATCAGTTACAATGACATCTCGAGATGTCATTGTAACTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-4525s1c1
Sequence:CCGGCCAGTATAAGACGTGGACATTCTCGAGAATGTCCACGTCTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-547s1c1
Sequence:CCGGGCCCTATTTCATCGGGATCTTCTCGAGAAGATCCCGATGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000718.2-3770s21c1
Sequence:CCGGCTTCACCCTGGAGCCTATTTCCTCGAGGAAATAGGCTCCAGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000718.2-7317s21c1
Sequence:CCGGTTACTCTAGACGACGAATAAACTCGAGTTTATTCGTCGTCTAGAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000718
CACNA1B MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, N type, alpha 1B subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-1403s1c1
Sequence:CCGGGCCACCAAGAAGAGCAGAAATCTCGAGATTTCTGCTCTTCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-5497s1c1
Sequence:CCGGCGAGGACATGACTGTTCACTTCTCGAGAAGTGAACAGTCATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-5371s1c1
Sequence:CCGGGCGCATCAGTTACAATGACATCTCGAGATGTCATTGTAACTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-4525s1c1
Sequence:CCGGCCAGTATAAGACGTGGACATTCTCGAGAATGTCCACGTCTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-547s1c1
Sequence:CCGGGCCCTATTTCATCGGGATCTTCTCGAGAAGATCCCGATGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000718.2-3770s21c1
Sequence:CCGGCTTCACCCTGGAGCCTATTTCCTCGAGGAAATAGGCTCCAGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000718.2-7317s21c1
Sequence:CCGGTTACTCTAGACGACGAATAAACTCGAGTTTATTCGTCGTCTAGAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000718
CACNA1B MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, N type, alpha 1B subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-1403s1c1
Sequence:CCGGGCCACCAAGAAGAGCAGAAATCTCGAGATTTCTGCTCTTCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-5497s1c1
Sequence:CCGGCGAGGACATGACTGTTCACTTCTCGAGAAGTGAACAGTCATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-5371s1c1
Sequence:CCGGGCGCATCAGTTACAATGACATCTCGAGATGTCATTGTAACTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-4525s1c1
Sequence:CCGGCCAGTATAAGACGTGGACATTCTCGAGAATGTCCACGTCTTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000718.1-547s1c1
Sequence:CCGGGCCCTATTTCATCGGGATCTTCTCGAGAAGATCCCGATGAAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000718.2-3770s21c1
Sequence:CCGGCTTCACCCTGGAGCCTATTTCCTCGAGGAAATAGGCTCCAGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000718.2-7317s21c1
Sequence:CCGGTTACTCTAGACGACGAATAAACTCGAGTTTATTCGTCGTCTAGAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007579
CACNA1B MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, N type, alpha 1B subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-3627s1c1
Sequence:CCGGCGCTTTAGAGTACATGGATTACTCGAGTAATCCATGTACTCTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-523s1c1
Sequence:CCGGCCTTACTTCATCGGGATCTTTCTCGAGAAAGATCCCGATGAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-4958s1c1
Sequence:CCGGCCCTTGATGATGACACCAGTACTCGAGTACTGGTGTCATCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-2119s1c1
Sequence:CCGGGCCGTAATGTATCATGGGATTCTCGAGAATCCCATGATACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007579.1-6999s1c1
Sequence:CCGGCCACCCATGTACCAGCTCCATCTCGAGATGGAGCTGGTACATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007579
CACNA1B MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, N type, alpha 1B subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-3627s1c1
Sequence:CCGGCGCTTTAGAGTACATGGATTACTCGAGTAATCCATGTACTCTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-523s1c1
Sequence:CCGGCCTTACTTCATCGGGATCTTTCTCGAGAAAGATCCCGATGAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-4958s1c1
Sequence:CCGGCCCTTGATGATGACACCAGTACTCGAGTACTGGTGTCATCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-2119s1c1
Sequence:CCGGGCCGTAATGTATCATGGGATTCTCGAGAATCCCATGATACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007579.1-6999s1c1
Sequence:CCGGCCACCCATGTACCAGCTCCATCTCGAGATGGAGCTGGTACATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007579
CACNA1B MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, N type, alpha 1B subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-3627s1c1
Sequence:CCGGCGCTTTAGAGTACATGGATTACTCGAGTAATCCATGTACTCTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-523s1c1
Sequence:CCGGCCTTACTTCATCGGGATCTTTCTCGAGAAAGATCCCGATGAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-4958s1c1
Sequence:CCGGCCCTTGATGATGACACCAGTACTCGAGTACTGGTGTCATCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007579.1-2119s1c1
Sequence:CCGGGCCGTAATGTATCATGGGATTCTCGAGAATCCCATGATACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007579.1-6999s1c1
Sequence:CCGGCCACCCATGTACCAGCTCCATCTCGAGATGGAGCTGGTACATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks