EMAIL THIS PAGE TO A FRIEND

CACNA1C

calcium channel, voltage-dependent, L type, alpha 1C subunit

188 Gene Product Result for
Synonyms: CACH2 CACN2 CACNL1A1 CCHL1A1 CaV1.2 LQT8 TS
Gene ID:
Human(775) Summary: This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]
Mouse(12288) calcium channel, voltage-dependent, L type, alpha 1C subunit
Rat(24239) calcium channel, voltage-dependent, L type, alpha 1C subunit
Zebrafish(170581) calcium channel, voltage-dependent, L type, alpha 1C subunit
cow(408015) calcium channel, voltage-dependent, L type, alpha 1C subunit
Horse(100049924) calcium channel, voltage-dependent, L type, alpha 1C subunit
chicken(395891) calcium channel, voltage-dependent, L type, alpha 1C subunit
domestic cat(101082923) calcium channel, voltage-dependent, L type, alpha 1C subunit
dog(403516) calcium channel, voltage-dependent, L type, alpha 1C subunit
naked mole-rat(101717129) calcium channel, voltage-dependent, L type, alpha 1C subunit
domestic guinea pig(100135490) calcium channel, voltage-dependent, L type, alpha 1C subunit
Goat(100861292) calcium channel, voltage-dependent, L type, alpha 1C subunit
sheep(101116562) calcium channel, voltage-dependent, L type, alpha 1C subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing
B112 (±)-Bay K8644 calcium channel agonist rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000719 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000719 Rosetta Predictions human pricing
NM_012517 Rosetta Predictions rat pricing
NM_009781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201607 predicted 1817
2 SASI_Hs01_00201609 predicted 1423
3 SASI_Hs01_00201610 predicted 1165
4 SASI_Hs02_00303135 predicted 4168
5 SASI_Hs01_00201611 predicted 951
6 SASI_Hs01_00201612 predicted 4188
7 SASI_Hs01_00201613 predicted 3403
8 SASI_Hs01_00201614 predicted 4115
9 SASI_Hs01_00201615 predicted 5553
10 SASI_Hs01_00201616 predicted 3228
11 SASI_Hs01_00201608 predicted 4070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259581 predicted 4415
2 SASI_Rn01_00073647 predicted 5418
3 SASI_Rn01_00073648 predicted 4396
4 SASI_Rn01_00073649 predicted 5472
5 SASI_Rn01_00073650 predicted 962
6 SASI_Rn01_00073651 predicted 4199
7 SASI_Rn01_00073652 predicted 621
8 SASI_Rn02_00259582 predicted 6675
9 SASI_Rn01_00073653 predicted 3346
10 SASI_Rn01_00073654 predicted 4760
11 SASI_Rn01_00073655 predicted 1174
12 SASI_Rn01_00073656 predicted 3932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039775 predicted 2906
2 SASI_Mm01_00039778 predicted 4009
3 SASI_Mm01_00039779 predicted 4677
4 SASI_Mm01_00039780 predicted 4301
5 SASI_Mm01_00039782 predicted 979
6 SASI_Mm01_00039783 predicted 4768
7 SASI_Mm01_00039784 predicted 4581
8 SASI_Mm02_00317010 predicted 3286
9 SASI_Mm02_00317011 predicted 4808
10 SASI_Mm02_00317012 predicted 4528
11 SASI_Mm01_00039776 predicted 4364
12 SASI_Mm01_00039777 predicted 5309
13 SASI_Mm01_00039781 predicted 1265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009781
CACNA1C MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1C subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-3469s21c1
Sequence:CCGGAGAATGCAAGGGTAACTATATCTCGAGATATAGTTACCCTTGCATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-1163s21c1
Sequence:CCGGTACAACCAGGAGGGCATAATACTCGAGTATTATGCCCTCCTGGTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-2320s21c1
Sequence:CCGGCCGTAGGAGCACGTTCGATAACTCGAGTTATCGAACGTGCTCCTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009781.1-8424s1c1
Sequence:CCGGGCCCAGTAACTTGTTCCAATTCTCGAGAATTGGAACAAGTTACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-4721s1c1
Sequence:CCGGCCAGAGACAATGTGTGGAATACTCGAGTATTCCACACATTGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-4913s1c1
Sequence:CCGGCGCCATGAATATACTCAACATCTCGAGATGTTGAGTATATTCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-1512s1c1
Sequence:CCGGGCGTGCATAAGCATTGTTGAACTCGAGTTCAACAATGCTTATGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-6637s1c1
Sequence:CCGGCCACGGTGAATCAGGAGATATCTCGAGATATCTCCTGATTCACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009781
CACNA1C MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1C subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-3469s21c1
Sequence:CCGGAGAATGCAAGGGTAACTATATCTCGAGATATAGTTACCCTTGCATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-1163s21c1
Sequence:CCGGTACAACCAGGAGGGCATAATACTCGAGTATTATGCCCTCCTGGTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-2320s21c1
Sequence:CCGGCCGTAGGAGCACGTTCGATAACTCGAGTTATCGAACGTGCTCCTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009781.1-8424s1c1
Sequence:CCGGGCCCAGTAACTTGTTCCAATTCTCGAGAATTGGAACAAGTTACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-4721s1c1
Sequence:CCGGCCAGAGACAATGTGTGGAATACTCGAGTATTCCACACATTGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-4913s1c1
Sequence:CCGGCGCCATGAATATACTCAACATCTCGAGATGTTGAGTATATTCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-1512s1c1
Sequence:CCGGGCGTGCATAAGCATTGTTGAACTCGAGTTCAACAATGCTTATGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-6637s1c1
Sequence:CCGGCCACGGTGAATCAGGAGATATCTCGAGATATCTCCTGATTCACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009781
CACNA1C MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1C subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-3469s21c1
Sequence:CCGGAGAATGCAAGGGTAACTATATCTCGAGATATAGTTACCCTTGCATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-1163s21c1
Sequence:CCGGTACAACCAGGAGGGCATAATACTCGAGTATTATGCCCTCCTGGTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009781.3-2320s21c1
Sequence:CCGGCCGTAGGAGCACGTTCGATAACTCGAGTTATCGAACGTGCTCCTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009781.1-8424s1c1
Sequence:CCGGGCCCAGTAACTTGTTCCAATTCTCGAGAATTGGAACAAGTTACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-4721s1c1
Sequence:CCGGCCAGAGACAATGTGTGGAATACTCGAGTATTCCACACATTGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-4913s1c1
Sequence:CCGGCGCCATGAATATACTCAACATCTCGAGATGTTGAGTATATTCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-1512s1c1
Sequence:CCGGGCGTGCATAAGCATTGTTGAACTCGAGTTCAACAATGCTTATGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009781.1-6637s1c1
Sequence:CCGGCCACGGTGAATCAGGAGATATCTCGAGATATCTCCTGATTCACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000719
CACNA1C MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1C subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000719.6-3525s21c1
Sequence:CCGGGCAACTACATCACGTACAAAGCTCGAGCTTTGTACGTGATGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000719.6-4130s21c1
Sequence:CCGGTTCAAACCCAAGCACTATTTCCTCGAGGAAATAGTGCTTGGGTTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-1822s1c1
Sequence:CCGGCGCAGTCAAGTCTAATGTCTTCTCGAGAAGACATTAGACTTGACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-2438s1c1
Sequence:CCGGCCAGGGATGTTAGTCTGTATTCTCGAGAATACAGACTAACATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-6466s1c1
Sequence:CCGGCGACATGACCATAGAGGAGATCTCGAGATCTCCTCTATGGTCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-3886s1c1
Sequence:CCGGGCACCAGTACAAAGTGTGGTACTCGAGTACCACACTTTGTACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-5150s1c1
Sequence:CCGGCGGAAGTTCAAGAAGCGCAAACTCGAGTTTGCGCTTCTTGAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000719
CACNA1C MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1C subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000719.6-3525s21c1
Sequence:CCGGGCAACTACATCACGTACAAAGCTCGAGCTTTGTACGTGATGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000719.6-4130s21c1
Sequence:CCGGTTCAAACCCAAGCACTATTTCCTCGAGGAAATAGTGCTTGGGTTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-1822s1c1
Sequence:CCGGCGCAGTCAAGTCTAATGTCTTCTCGAGAAGACATTAGACTTGACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-2438s1c1
Sequence:CCGGCCAGGGATGTTAGTCTGTATTCTCGAGAATACAGACTAACATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-6466s1c1
Sequence:CCGGCGACATGACCATAGAGGAGATCTCGAGATCTCCTCTATGGTCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-3886s1c1
Sequence:CCGGGCACCAGTACAAAGTGTGGTACTCGAGTACCACACTTTGTACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-5150s1c1
Sequence:CCGGCGGAAGTTCAAGAAGCGCAAACTCGAGTTTGCGCTTCTTGAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000719
CACNA1C MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1C subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000719.6-3525s21c1
Sequence:CCGGGCAACTACATCACGTACAAAGCTCGAGCTTTGTACGTGATGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000719.6-4130s21c1
Sequence:CCGGTTCAAACCCAAGCACTATTTCCTCGAGGAAATAGTGCTTGGGTTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-1822s1c1
Sequence:CCGGCGCAGTCAAGTCTAATGTCTTCTCGAGAAGACATTAGACTTGACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-2438s1c1
Sequence:CCGGCCAGGGATGTTAGTCTGTATTCTCGAGAATACAGACTAACATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-6466s1c1
Sequence:CCGGCGACATGACCATAGAGGAGATCTCGAGATCTCCTCTATGGTCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-3886s1c1
Sequence:CCGGGCACCAGTACAAAGTGTGGTACTCGAGTACCACACTTTGTACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000719.3-5150s1c1
Sequence:CCGGCGGAAGTTCAAGAAGCGCAAACTCGAGTTTGCGCTTCTTGAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)