EMAIL THIS PAGE TO A FRIEND

CACNA1D

calcium channel, voltage-dependent, L type, alpha 1D subunit

91 Gene Product Result for
Synonyms: CACH3 CACN4 CACNL1A2 CCHL1A2 Cav1.3 SANDD
UniProtKB ID: Q01668, B0FYA3, Q13916, Q13931, Q9UDC3
Gene ID:
Human(776) Summary: Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, namely alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1D subunit. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(12289) calcium channel, voltage-dependent, L type, alpha 1D subunit
Rat(29716) calcium channel, voltage-dependent, L type, alpha 1D subunit
chicken(395895) calcium channel, voltage-dependent, L type, alpha 1D subunit
Horse(100051186) calcium channel, voltage-dependent, L type, alpha 1D subunit
cow(408013) calcium channel, voltage-dependent, L type, alpha 1D subunit
domestic cat(101088394) calcium channel, voltage-dependent, L type, alpha 1D subunit
dog(484724) calcium channel, voltage-dependent, L type, alpha 1D subunit
sheep(101106371) calcium channel, voltage-dependent, L type, alpha 1D subunit
Domestic Rabbit(100327259) calcium channel, voltage-dependent, L type, alpha 1D subunit
domestic guinea pig(100726255) calcium channel, voltage-dependent, L type, alpha 1D subunit
naked mole-rat(101714832) calcium channel, voltage-dependent, L type, alpha 1D subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
M8278 Margatoxin ≥90% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123041 MISSION® esiRNA esiRNA human CACNA1D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000720 Rosetta Predictions human pricing
NM_017298 Rosetta Predictions rat pricing
NM_001083616 Rosetta Predictions mouse pricing
NM_028981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054832 predicted 5235
2 SASI_Hs02_00303136 predicted 3781
3 SASI_Hs02_00303137 predicted 2079
4 SASI_Hs01_00054834 predicted 2916
5 SASI_Hs01_00054835 predicted 5334
6 SASI_Hs01_00054836 predicted 3170
7 SASI_Hs01_00054837 predicted 5061
8 SASI_Hs01_00054838 predicted 3293
9 SASI_Hs01_00054839 predicted 1544
10 SASI_Hs02_00303138 predicted 1240
11 SASI_Hs01_00054833 predicted 736
12 SASI_Hs01_00054840 predicted 1324
13 SASI_Hs01_00054841 predicted 4331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063215 predicted 963
2 SASI_Rn01_00063216 predicted 5884
3 SASI_Rn01_00063217 predicted 5639
4 SASI_Rn01_00063218 predicted 3775
5 SASI_Rn02_00261737 predicted 4495
6 SASI_Rn01_00063219 predicted 1372
7 SASI_Rn01_00063220 predicted 1743
8 SASI_Rn01_00063221 predicted 1115
9 SASI_Rn01_00063224 predicted 7009
10 SASI_Rn02_00261738 predicted 1980
11 SASI_Rn01_00063222 predicted 1563
12 SASI_Rn01_00063223 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299721 predicted 5498
2 SASI_Mm02_00299722 predicted 1524
3 SASI_Mm02_00299723 predicted 3757
4 SASI_Mm02_00299724 predicted 2147
5 SASI_Mm02_00299725 predicted 6673
6 SASI_Mm02_00299726 predicted 3744
7 SASI_Mm02_00299727 predicted 3819
8 SASI_Mm02_00299728 predicted 5375
9 SASI_Mm02_00299729 predicted 947
10 SASI_Mm02_00299730 predicted 5856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197884 predicted 5124
2 SASI_Mm01_00197885 predicted 1148
3 SASI_Mm01_00197886 predicted 3379
4 SASI_Mm01_00197887 predicted 1777
5 SASI_Mm01_00197888 predicted 6303
6 SASI_Mm01_00197891 predicted 3367
7 SASI_Mm01_00197892 predicted 3444
8 SASI_Mm01_00197893 predicted 4996
9 SASI_Mm02_00334717 predicted 579
10 SASI_Mm02_00334718 predicted 5482
11 SASI_Mm01_00197889 predicted 737
12 SASI_Mm01_00197890 predicted 751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028981
CACNA1D MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1D subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-474s1c1
Sequence:CCGGCCTGCATTAGTATAGTGGAATCTCGAGATTCCACTATACTAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-5452s1c1
Sequence:CCGGGCTTCAAAGAAGGTCCAGTATCTCGAGATACTGGACCTTCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-122s1c1
Sequence:CCGGGCCCGATATAAAGGCAGAGTTCTCGAGAACTCTGCCTTTATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-2293s1c1
Sequence:CCGGCGGGATGATTGTCTGTATCTACTCGAGTAGATACAGACAATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-4648s1c1
Sequence:CCGGCCGAGTAGCATGTAAGAGATTCTCGAGAATCTCTTACATGCTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028981
CACNA1D MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1D subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-474s1c1
Sequence:CCGGCCTGCATTAGTATAGTGGAATCTCGAGATTCCACTATACTAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-5452s1c1
Sequence:CCGGGCTTCAAAGAAGGTCCAGTATCTCGAGATACTGGACCTTCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-122s1c1
Sequence:CCGGGCCCGATATAAAGGCAGAGTTCTCGAGAACTCTGCCTTTATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-2293s1c1
Sequence:CCGGCGGGATGATTGTCTGTATCTACTCGAGTAGATACAGACAATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-4648s1c1
Sequence:CCGGCCGAGTAGCATGTAAGAGATTCTCGAGAATCTCTTACATGCTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028981
CACNA1D MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1D subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-474s1c1
Sequence:CCGGCCTGCATTAGTATAGTGGAATCTCGAGATTCCACTATACTAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-5452s1c1
Sequence:CCGGGCTTCAAAGAAGGTCCAGTATCTCGAGATACTGGACCTTCTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-122s1c1
Sequence:CCGGGCCCGATATAAAGGCAGAGTTCTCGAGAACTCTGCCTTTATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-2293s1c1
Sequence:CCGGCGGGATGATTGTCTGTATCTACTCGAGTAGATACAGACAATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028981.1-4648s1c1
Sequence:CCGGCCGAGTAGCATGTAAGAGATTCTCGAGAATCTCTTACATGCTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000720
CACNA1D MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1D subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-5143s1c1
Sequence:CCGGGCGTGCTATATCGTGTGATTTCTCGAGAAATCACACGATATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-2980s1c1
Sequence:CCGGCCTGTTGAAGATGACAACTTTCTCGAGAAAGTTGTCATCTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-5072s1c1
Sequence:CCGGCCTGCGAAGAACACCACAATTCTCGAGAATTGTGGTGTTCTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-4044s1c1
Sequence:CCGGCGGACCCAACTGAAAGTGAAACTCGAGTTTCACTTTCAGTTGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-255s1c1
Sequence:CCGGCCAAGCAAACTGTCCTGTCTTCTCGAGAAGACAGGACAGTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-4356s21c1
Sequence:CCGGGAGATAACAACCAGATCAATACTCGAGTATTGATCTGGTTGTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-5136s21c1
Sequence:CCGGTTGCCCTACAGGCGGGATTAACTCGAGTTAATCCCGCCTGTAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-1952s21c1
Sequence:CCGGTTGGGCCTCCAAGCATATTTCCTCGAGGAAATATGCTTGGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000720.2-7550s21c1
Sequence:CCGGATATCCATGGGTCCTAATAATCTCGAGATTATTAGGACCCATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-700s21c1
Sequence:CCGGGATTATAGCGTATGGATTATTCTCGAGAATAATCCATACGCTATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000720
CACNA1D MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1D subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-5143s1c1
Sequence:CCGGGCGTGCTATATCGTGTGATTTCTCGAGAAATCACACGATATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-2980s1c1
Sequence:CCGGCCTGTTGAAGATGACAACTTTCTCGAGAAAGTTGTCATCTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-5072s1c1
Sequence:CCGGCCTGCGAAGAACACCACAATTCTCGAGAATTGTGGTGTTCTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-4044s1c1
Sequence:CCGGCGGACCCAACTGAAAGTGAAACTCGAGTTTCACTTTCAGTTGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-255s1c1
Sequence:CCGGCCAAGCAAACTGTCCTGTCTTCTCGAGAAGACAGGACAGTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-4356s21c1
Sequence:CCGGGAGATAACAACCAGATCAATACTCGAGTATTGATCTGGTTGTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-5136s21c1
Sequence:CCGGTTGCCCTACAGGCGGGATTAACTCGAGTTAATCCCGCCTGTAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-1952s21c1
Sequence:CCGGTTGGGCCTCCAAGCATATTTCCTCGAGGAAATATGCTTGGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000720.2-7550s21c1
Sequence:CCGGATATCCATGGGTCCTAATAATCTCGAGATTATTAGGACCCATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-700s21c1
Sequence:CCGGGATTATAGCGTATGGATTATTCTCGAGAATAATCCATACGCTATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000720
CACNA1D MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1D subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-5143s1c1
Sequence:CCGGGCGTGCTATATCGTGTGATTTCTCGAGAAATCACACGATATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-2980s1c1
Sequence:CCGGCCTGTTGAAGATGACAACTTTCTCGAGAAAGTTGTCATCTTCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-5072s1c1
Sequence:CCGGCCTGCGAAGAACACCACAATTCTCGAGAATTGTGGTGTTCTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-4044s1c1
Sequence:CCGGCGGACCCAACTGAAAGTGAAACTCGAGTTTCACTTTCAGTTGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000720.1-255s1c1
Sequence:CCGGCCAAGCAAACTGTCCTGTCTTCTCGAGAAGACAGGACAGTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-4356s21c1
Sequence:CCGGGAGATAACAACCAGATCAATACTCGAGTATTGATCTGGTTGTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-5136s21c1
Sequence:CCGGTTGCCCTACAGGCGGGATTAACTCGAGTTAATCCCGCCTGTAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-1952s21c1
Sequence:CCGGTTGGGCCTCCAAGCATATTTCCTCGAGGAAATATGCTTGGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000720.2-7550s21c1
Sequence:CCGGATATCCATGGGTCCTAATAATCTCGAGATTATTAGGACCCATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000720.2-700s21c1
Sequence:CCGGGATTATAGCGTATGGATTATTCTCGAGAATAATCCATACGCTATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks