EMAIL THIS PAGE TO A FRIEND

CACNA1E

calcium channel, voltage-dependent, R type, alpha 1E subunit

190 Gene Product Result for
Synonyms: BII CACH6 CACNL1A6 Cav2.3
UniProtKB ID: Q15878, B1AM12, B1AM13, B1AM14, Q14580, Q14581
Gene ID:
Human(777) Summary: Voltage-dependent calcium channels are multisubunit complexes consisting of alpha-1, alpha-2, beta, and delta subunits in a 1:1:1:1 ratio. These channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division and cell death. This gene encodes the alpha-1E subunit of the R-type calcium channels, which belong to the 'high-voltage activated' group that maybe involved in the modulation of firing patterns of neurons important for information processing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
Mouse(12290) calcium channel, voltage-dependent, R type, alpha 1E subunit
Rat(54234) calcium channel, voltage-dependent, R type, alpha 1E subunit
Zebrafish(567702) voltage-dependent R-type calcium channel subunit alpha-1E
cow(353113) calcium channel, voltage-dependent, R type, alpha 1E subunit
domestic cat(101093985) calcium channel, voltage-dependent, R type, alpha 1E subunit
dog(490305) calcium channel, voltage-dependent, R type, alpha 1E subunit
chicken(424412) calcium channel, voltage-dependent, R type, alpha 1E subunit
naked mole-rat(101701145) calcium channel, voltage-dependent, R type, alpha 1E subunit
domestic guinea pig(100716749) calcium channel, voltage-dependent, R type, alpha 1E subunit
sheep(101102503) calcium channel, voltage-dependent, R type, alpha 1E subunit
Domestic Rabbit(100009403) calcium channel, voltage-dependent, R type, alpha 1E subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000721 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000721 Rosetta Predictions human pricing
NM_019294 Rosetta Predictions rat pricing
NM_009782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099087 predicted 5435
2 SASI_Hs02_00303139 predicted 5073
3 SASI_Hs01_00099089 predicted 4150
4 SASI_Hs01_00099090 predicted 1572
5 SASI_Hs01_00099091 predicted 1813
6 SASI_Hs01_00099092 predicted 6321
7 SASI_Hs01_00099093 predicted 5561
8 SASI_Hs02_00303140 predicted 1451
9 SASI_Hs01_00099094 predicted 5521
10 SASI_Hs01_00099095 predicted 1525
11 SASI_Hs01_00099088 predicted 3107
12 SASI_Hs01_00099096 predicted 6731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093519 predicted 3708
2 SASI_Rn01_00093520 predicted 5226
3 SASI_Rn01_00093522 predicted 3700
4 SASI_Rn01_00093524 predicted 4562
5 SASI_Rn01_00093525 predicted 1229
6 SASI_Rn01_00093526 predicted 3943
7 SASI_Rn01_00093527 predicted 4866
8 SASI_Rn01_00093528 predicted 5996
9 SASI_Rn02_00262251 predicted 5942
10 SASI_Rn02_00262252 predicted 5303
11 SASI_Rn01_00093521 predicted 6594
12 SASI_Rn01_00093523 predicted 5198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079274 predicted 3752
2 SASI_Mm02_00317013 predicted 6556
3 SASI_Mm01_00079275 predicted 1452
4 SASI_Mm01_00079276 predicted 1227
5 SASI_Mm01_00079277 predicted 5922
6 SASI_Mm01_00079278 predicted 4618
7 SASI_Mm01_00079280 predicted 3931
8 SASI_Mm02_00317014 predicted 595
9 SASI_Mm02_00317015 predicted 6571
10 SASI_Mm01_00079281 predicted 2039
11 SASI_Mm01_00079279 predicted 1053
12 SASI_Mm01_00079282 predicted 936
13 SASI_Mm01_00079283 predicted 4206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009782
CACNA1E MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, R type, alpha 1E subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-376s21c1
Sequence:CCGGGGAGAAGACAGAACCATATTTCTCGAGAAATATGGTTCTGTCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-4522s21c1
Sequence:CCGGCACCTATGAGCTCGCCTTAAACTCGAGTTTAAGGCGAGCTCATAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-5924s21c1
Sequence:CCGGAGCTCTATGCGACGTTCATTTCTCGAGAAATGAACGTCGCATAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-5097s21c1
Sequence:CCGGCTGACCTGGCCTACGTTTATTCTCGAGAATAAACGTAGGCCAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-3926s1c1
Sequence:CCGGCGCTACTTTGAAATGTGCATTCTCGAGAATGCACATTTCAAAGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-1282s1c1
Sequence:CCGGCCCGGCTGGTTATGAATGTAACTCGAGTTACATTCATAACCAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-2185s1c1
Sequence:CCGGCCGGCTCCTAAGGATATTTAACTCGAGTTAAATATCCTTAGGAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-6421s1c1
Sequence:CCGGGCGTTCAAATTCCTCCTGGTTCTCGAGAACCAGGAGGAATTTGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-5681s1c1
Sequence:CCGGCCTCACCACTTAGATGAGTTTCTCGAGAAACTCATCTAAGTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009782
CACNA1E MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, R type, alpha 1E subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-376s21c1
Sequence:CCGGGGAGAAGACAGAACCATATTTCTCGAGAAATATGGTTCTGTCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-4522s21c1
Sequence:CCGGCACCTATGAGCTCGCCTTAAACTCGAGTTTAAGGCGAGCTCATAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-5924s21c1
Sequence:CCGGAGCTCTATGCGACGTTCATTTCTCGAGAAATGAACGTCGCATAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-5097s21c1
Sequence:CCGGCTGACCTGGCCTACGTTTATTCTCGAGAATAAACGTAGGCCAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-3926s1c1
Sequence:CCGGCGCTACTTTGAAATGTGCATTCTCGAGAATGCACATTTCAAAGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-1282s1c1
Sequence:CCGGCCCGGCTGGTTATGAATGTAACTCGAGTTACATTCATAACCAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-2185s1c1
Sequence:CCGGCCGGCTCCTAAGGATATTTAACTCGAGTTAAATATCCTTAGGAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-6421s1c1
Sequence:CCGGGCGTTCAAATTCCTCCTGGTTCTCGAGAACCAGGAGGAATTTGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-5681s1c1
Sequence:CCGGCCTCACCACTTAGATGAGTTTCTCGAGAAACTCATCTAAGTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009782
CACNA1E MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, R type, alpha 1E subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-376s21c1
Sequence:CCGGGGAGAAGACAGAACCATATTTCTCGAGAAATATGGTTCTGTCTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-4522s21c1
Sequence:CCGGCACCTATGAGCTCGCCTTAAACTCGAGTTTAAGGCGAGCTCATAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-5924s21c1
Sequence:CCGGAGCTCTATGCGACGTTCATTTCTCGAGAAATGAACGTCGCATAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009782.3-5097s21c1
Sequence:CCGGCTGACCTGGCCTACGTTTATTCTCGAGAATAAACGTAGGCCAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-3926s1c1
Sequence:CCGGCGCTACTTTGAAATGTGCATTCTCGAGAATGCACATTTCAAAGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-1282s1c1
Sequence:CCGGCCCGGCTGGTTATGAATGTAACTCGAGTTACATTCATAACCAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-2185s1c1
Sequence:CCGGCCGGCTCCTAAGGATATTTAACTCGAGTTAAATATCCTTAGGAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-6421s1c1
Sequence:CCGGGCGTTCAAATTCCTCCTGGTTCTCGAGAACCAGGAGGAATTTGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009782.2-5681s1c1
Sequence:CCGGCCTCACCACTTAGATGAGTTTCTCGAGAAACTCATCTAAGTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000721
CACNA1E MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, R type, alpha 1E subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000721.2-4599s21c1
Sequence:CCGGGTCCTTTGAGTACACCATTATCTCGAGATAATGGTGTACTCAAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000721.2-7221s21c1
Sequence:CCGGAGGAACGTGGAGGGTTATTACCTCGAGGTAATAACCCTCCACGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-3652s1c1
Sequence:CCGGCGCAACAAAGTCCTGAGGTATCTCGAGATACCTCAGGACTTTGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-5379s1c1
Sequence:CCGGCCGCATCCATTACACTGAGATCTCGAGATCTCAGTGTAATGGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-3042s1c1
Sequence:CCGGCCAGGATTTAAGGAGGACCAACTCGAGTTGGTCCTCCTTAAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-429s1c1
Sequence:CCGGGCCGCCATTTGAGTACATGATCTCGAGATCATGTACTCAAATGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-6060s1c1
Sequence:CCGGGCGTTCAAATTCCTCGTGGTTCTCGAGAACCACGAGGAATTTGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000721
CACNA1E MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, R type, alpha 1E subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000721.2-4599s21c1
Sequence:CCGGGTCCTTTGAGTACACCATTATCTCGAGATAATGGTGTACTCAAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000721.2-7221s21c1
Sequence:CCGGAGGAACGTGGAGGGTTATTACCTCGAGGTAATAACCCTCCACGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-3652s1c1
Sequence:CCGGCGCAACAAAGTCCTGAGGTATCTCGAGATACCTCAGGACTTTGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-5379s1c1
Sequence:CCGGCCGCATCCATTACACTGAGATCTCGAGATCTCAGTGTAATGGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-3042s1c1
Sequence:CCGGCCAGGATTTAAGGAGGACCAACTCGAGTTGGTCCTCCTTAAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-429s1c1
Sequence:CCGGGCCGCCATTTGAGTACATGATCTCGAGATCATGTACTCAAATGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-6060s1c1
Sequence:CCGGGCGTTCAAATTCCTCGTGGTTCTCGAGAACCACGAGGAATTTGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000721
CACNA1E MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, R type, alpha 1E subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000721.2-4599s21c1
Sequence:CCGGGTCCTTTGAGTACACCATTATCTCGAGATAATGGTGTACTCAAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000721.2-7221s21c1
Sequence:CCGGAGGAACGTGGAGGGTTATTACCTCGAGGTAATAACCCTCCACGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-3652s1c1
Sequence:CCGGCGCAACAAAGTCCTGAGGTATCTCGAGATACCTCAGGACTTTGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-5379s1c1
Sequence:CCGGCCGCATCCATTACACTGAGATCTCGAGATCTCAGTGTAATGGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-3042s1c1
Sequence:CCGGCCAGGATTTAAGGAGGACCAACTCGAGTTGGTCCTCCTTAAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-429s1c1
Sequence:CCGGGCCGCCATTTGAGTACATGATCTCGAGATCATGTACTCAAATGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000721.1-6060s1c1
Sequence:CCGGGCGTTCAAATTCCTCGTGGTTCTCGAGAACCACGAGGAATTTGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)