EMAIL THIS PAGE TO A FRIEND

CACNA1F

calcium channel, voltage-dependent, L type, alpha 1F subunit

51 Gene Product Result for
Synonyms: AIED COD3 COD4 CORDX CORDX3 CSNB2 CSNB2A CSNBX2 Cav1.4 Cav1.4alpha1 JM8 JMC8 OA2
UniProtKB ID: O60840, A6NI29, O43901, O95226, Q9UHB1
Gene ID:
Human(778) Summary: This gene encodes a member of the alpha-1 subunit family; a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been shown to cause incomplete X-linked congential stationary night blindness type 2 (CSNB2). [provided by RefSeq, Feb 2012]
Mouse(54652) calcium channel, voltage-dependent, alpha 1F subunit
Rat(114493) calcium channel, voltage-dependent, L type, alpha 1F subunit
sheep(101104552) calcium channel, voltage-dependent, L type, alpha 1F subunit
domestic guinea pig(100720484) calcium channel, voltage-dependent, L type, alpha 1F subunit
naked mole-rat(101722090) calcium channel, voltage-dependent, L type, alpha 1F subunit
Zebrafish(386662) calcium channel, voltage-dependent, alpha 1F subunit
dog(480915) calcium channel, voltage-dependent, L type, alpha 1F subunit
cow(509779) calcium channel, voltage-dependent, L type, alpha 1F subunit
domestic cat(101080870) calcium channel, voltage-dependent, L type, alpha 1F subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005183 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156011 MISSION® esiRNA esiRNA human CACNA1F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005183 Rosetta Predictions human pricing
NM_053701 Rosetta Predictions rat pricing
NM_019582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059726 predicted 3854
2 SASI_Hs02_00339130 predicted 4387
3 SASI_Hs01_00059728 predicted 2809
4 SASI_Hs01_00059729 predicted 4234
5 SASI_Hs01_00059730 predicted 3826
6 SASI_Hs01_00059731 predicted 857
7 SASI_Hs01_00059732 predicted 452
8 SASI_Hs02_00339131 predicted 4129
9 SASI_Hs01_00059734 predicted 3583
10 SASI_Hs01_00059735 predicted 3011
11 SASI_Hs01_00059727 predicted 4001
12 SASI_Hs01_00059733 predicted 5538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066197 predicted 3361
2 SASI_Rn01_00066198 predicted 986
3 SASI_Rn01_00066199 predicted 4020
4 SASI_Rn01_00066200 predicted 1629
5 SASI_Rn01_00066202 predicted 646
6 SASI_Rn01_00066203 predicted 3889
7 SASI_Rn01_00066204 predicted 4584
8 SASI_Rn01_00066205 predicted 4359
9 SASI_Rn01_00066206 predicted 4704
10 SASI_Rn02_00266468 predicted 2742
11 SASI_Rn01_00066201 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108685 predicted 1000
2 SASI_Mm02_00324645 predicted 706
3 SASI_Mm01_00108686 predicted 1966
4 SASI_Mm02_00324646 predicted 424
5 SASI_Mm01_00108687 predicted 3942
6 SASI_Mm01_00108688 predicted 834
7 SASI_Mm02_00324647 predicted 4728
8 SASI_Mm01_00108689 predicted 4029
9 SASI_Mm01_00108690 predicted 778
10 SASI_Mm01_00108691 predicted 3916
11 SASI_Mm01_00108684 predicted 3400
12 SASI_Mm01_00108692 predicted 662
13 SASI_Mm01_00108693 predicted 3827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019582
CACNA1F MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1F subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-3574s1c1
Sequence:CCGGCGCCGATACATCCCTAAGAATCTCGAGATTCTTAGGGATGTATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-3928s1c1
Sequence:CCGGCGCATATCTATCACGTTCTTTCTCGAGAAAGAACGTGATAGATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-2760s1c1
Sequence:CCGGCCGAAACCATATTCTGGGATACTCGAGTATCCCAGAATATGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-4283s1c1
Sequence:CCGGGCGAGGAATTTACCTGTGGTACTCGAGTACCACAGGTAAATTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-786s1c1
Sequence:CCGGCGTCATTATCATTTACGCCATCTCGAGATGGCGTAAATGATAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4044s21c1
Sequence:CCGGCACTTCTCATAGCAATGATATCTCGAGATATCATTGCTATGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4114s21c1
Sequence:CCGGTCAGGACGGCACGCAGATAAACTCGAGTTTATCTGCGTGCCGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4391s21c1
Sequence:CCGGCTAACCAGAGATTGGTCTATCCTCGAGGATAGACCAATCTCTGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-500s21c1
Sequence:CCGGCTCCATCCCAGCGCCTATATTCTCGAGAATATAGGCGCTGGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-969s21c1
Sequence:CCGGGCATCACGAACTTCGACAATTCTCGAGAATTGTCGAAGTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019582
CACNA1F MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1F subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-3574s1c1
Sequence:CCGGCGCCGATACATCCCTAAGAATCTCGAGATTCTTAGGGATGTATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-3928s1c1
Sequence:CCGGCGCATATCTATCACGTTCTTTCTCGAGAAAGAACGTGATAGATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-2760s1c1
Sequence:CCGGCCGAAACCATATTCTGGGATACTCGAGTATCCCAGAATATGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-4283s1c1
Sequence:CCGGGCGAGGAATTTACCTGTGGTACTCGAGTACCACAGGTAAATTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-786s1c1
Sequence:CCGGCGTCATTATCATTTACGCCATCTCGAGATGGCGTAAATGATAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4044s21c1
Sequence:CCGGCACTTCTCATAGCAATGATATCTCGAGATATCATTGCTATGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4114s21c1
Sequence:CCGGTCAGGACGGCACGCAGATAAACTCGAGTTTATCTGCGTGCCGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4391s21c1
Sequence:CCGGCTAACCAGAGATTGGTCTATCCTCGAGGATAGACCAATCTCTGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-500s21c1
Sequence:CCGGCTCCATCCCAGCGCCTATATTCTCGAGAATATAGGCGCTGGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-969s21c1
Sequence:CCGGGCATCACGAACTTCGACAATTCTCGAGAATTGTCGAAGTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019582
CACNA1F MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1F subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-3574s1c1
Sequence:CCGGCGCCGATACATCCCTAAGAATCTCGAGATTCTTAGGGATGTATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-3928s1c1
Sequence:CCGGCGCATATCTATCACGTTCTTTCTCGAGAAAGAACGTGATAGATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-2760s1c1
Sequence:CCGGCCGAAACCATATTCTGGGATACTCGAGTATCCCAGAATATGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-4283s1c1
Sequence:CCGGGCGAGGAATTTACCTGTGGTACTCGAGTACCACAGGTAAATTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019582.1-786s1c1
Sequence:CCGGCGTCATTATCATTTACGCCATCTCGAGATGGCGTAAATGATAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4044s21c1
Sequence:CCGGCACTTCTCATAGCAATGATATCTCGAGATATCATTGCTATGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4114s21c1
Sequence:CCGGTCAGGACGGCACGCAGATAAACTCGAGTTTATCTGCGTGCCGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-4391s21c1
Sequence:CCGGCTAACCAGAGATTGGTCTATCCTCGAGGATAGACCAATCTCTGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-500s21c1
Sequence:CCGGCTCCATCCCAGCGCCTATATTCTCGAGAATATAGGCGCTGGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019582.2-969s21c1
Sequence:CCGGGCATCACGAACTTCGACAATTCTCGAGAATTGTCGAAGTTCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005183
CACNA1F MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1F subunit
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-5527s21c1
Sequence:CCGGCCTATCATCGTGGGCGAAATTCTCGAGAATTTCGCCCACGATGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-4796s1c1
Sequence:CCGGCCAGGACTATTTCCGCAAATTCTCGAGAATTTGCGGAAATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-727s1c1
Sequence:CCGGGCCTGCACATAGTGCTCAATTCTCGAGAATTGAGCACTATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-2171s1c1
Sequence:CCGGCGTGGTCATGTATGATGGTATCTCGAGATACCATCATACATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-3944s21c1
Sequence:CCGGCTTTCGCCTCTTCCGAGTTATCTCGAGATAACTCGGAAGAGGCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-4289s21c1
Sequence:CCGGGTTTACCTGTGGTAGCAATTTCTCGAGAAATTGCTACCACAGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005183
CACNA1F MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1F subunit
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-5527s21c1
Sequence:CCGGCCTATCATCGTGGGCGAAATTCTCGAGAATTTCGCCCACGATGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-4796s1c1
Sequence:CCGGCCAGGACTATTTCCGCAAATTCTCGAGAATTTGCGGAAATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-727s1c1
Sequence:CCGGGCCTGCACATAGTGCTCAATTCTCGAGAATTGAGCACTATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-2171s1c1
Sequence:CCGGCGTGGTCATGTATGATGGTATCTCGAGATACCATCATACATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-3944s21c1
Sequence:CCGGCTTTCGCCTCTTCCGAGTTATCTCGAGATAACTCGGAAGAGGCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-4289s21c1
Sequence:CCGGGTTTACCTGTGGTAGCAATTTCTCGAGAAATTGCTACCACAGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005183
CACNA1F MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1F subunit
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-5527s21c1
Sequence:CCGGCCTATCATCGTGGGCGAAATTCTCGAGAATTTCGCCCACGATGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-4796s1c1
Sequence:CCGGCCAGGACTATTTCCGCAAATTCTCGAGAATTTGCGGAAATAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-727s1c1
Sequence:CCGGGCCTGCACATAGTGCTCAATTCTCGAGAATTGAGCACTATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005183.1-2171s1c1
Sequence:CCGGCGTGGTCATGTATGATGGTATCTCGAGATACCATCATACATGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-3944s21c1
Sequence:CCGGCTTTCGCCTCTTCCGAGTTATCTCGAGATAACTCGGAAGAGGCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005183.2-4289s21c1
Sequence:CCGGGTTTACCTGTGGTAGCAATTTCTCGAGAAATTGCTACCACAGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks