EMAIL THIS PAGE TO A FRIEND

CACNA1G

calcium channel, voltage-dependent, T type, alpha 1G subunit

274 Gene Product Result for
Synonyms: Ca(V)T.1 Cav3.1 NBR13
Gene ID:
Human(8913) Summary: Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
Mouse(12291) calcium channel, voltage-dependent, T type, alpha 1G subunit
Rat(29717) calcium channel, voltage-dependent, T type, alpha 1G subunit
Zebrafish(563904) calcium channel, voltage-dependent, T type, alpha 1G subunit
dog(491083) calcium channel, voltage-dependent, T type, alpha 1G subunit
cow(282411) calcium channel, voltage-dependent, T type, alpha 1G subunit
Horse(100070000) calcium channel, voltage-dependent, T type, alpha 1G subunit
domestic cat(101098757) calcium channel, voltage-dependent, T type, alpha 1G subunit
chicken(769385) calcium channel, voltage-dependent, T type, alpha 1G subunit
naked mole-rat(101709921) calcium channel, voltage-dependent, T type, alpha 1G subunit
domestic guinea pig(100728128) calcium channel, voltage-dependent, T type, alpha 1G subunit
sheep(101117004) calcium channel, voltage-dependent, T type, alpha 1G subunit
Domestic Rabbit(100346309) calcium channel, voltage-dependent, T type, alpha 1G subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004714 Anti-CACNA1G antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104299 Anti-CACNA1G antibody produced in rabbit affinity isolated antibody human, mouse, canine, guinea pig, rabbit, rat, horse
western blot pricing
C5488 Anti-Calcium Channel (α1G Subunit) (T-type Voltage-Gated Ca2+ Channel) antibody produced in rabbit ~1 mg/mL, fractionated antiserum, buffered aqueous solution rat, mouse, human
western blot pricing
C2240 Anti-Calcium Channel CaV3.1 (α1G) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
western blot pricing
SAB5200465 Monoclonal Anti-Cav3.1 - Alkaline Phosphatase antibody produced in mouse clone S178A-9, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200466 Monoclonal Anti-Cav3.1 - Apc antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200457 Monoclonal Anti-Cav3.1 - Atto 390 antibody produced in mouse clone S178A-9, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200458 Monoclonal Anti-Cav3.1 - Atto 488 antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200459 Monoclonal Anti-Cav3.1 - Atto 565 antibody produced in mouse clone S178A-9, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200460 Monoclonal Anti-Cav3.1 - Atto 594 antibody produced in mouse clone S178A-9, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200461 Monoclonal Anti-Cav3.1 - Atto 633 antibody produced in mouse clone S178A-9, purified immunoglobulin rat, mouse, human
immunohistochemistry, western blot pricing
SAB5200462 Monoclonal Anti-Cav3.1 - Atto 655 antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200463 Monoclonal Anti-Cav3.1 - Atto 680 antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200464 Monoclonal Anti-Cav3.1 - Atto 700 antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200467 Monoclonal Anti-Cav3.1 - Biotin antibody produced in mouse clone S178A-9, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200468 Monoclonal Anti-Cav3.1 - Fitc antibody produced in mouse clone S178A-9, purified immunoglobulin rat, human, mouse
immunohistochemistry, western blot pricing
SAB5200469 Monoclonal Anti-Cav3.1 - Hrp antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200470 Monoclonal Anti-Cav3.1 - Pe/Atto 594 antibody produced in mouse clone S178A-9, purified immunoglobulin mouse, rat, human
immunohistochemistry, western blot pricing
SAB5200471 Monoclonal Anti-Cav3.1 - Percp antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200472 Monoclonal Anti-Cav3.1 - Rpe antibody produced in mouse clone S178A-9, purified immunoglobulin rat, mouse, human
immunohistochemistry, western blot pricing
SAB5200473 Monoclonal Anti-Cav3.1 - Streptavidin antibody produced in mouse clone S178A-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200456 Monoclonal Anti-Cav3.1 antibody produced in mouse clone S178A-9, purified immunoglobulin mouse, rat, human
immunohistochemistry, western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
K1514 Kurtoxin human, mouse, rat pricing
P1793 Pimozide human, mouse, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
E7138 Ethosuximide human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047631 MISSION® esiRNA esiRNA targeting mouse Cacna1g (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018896 Rosetta Predictions human pricing
NM_198376 Rosetta Predictions human pricing
NM_198377 Rosetta Predictions human pricing
NM_198378 Rosetta Predictions human pricing
NM_198379 Rosetta Predictions human pricing
NM_198380 Rosetta Predictions human pricing
NM_198382 Rosetta Predictions human pricing
NM_198383 Rosetta Predictions human pricing
NM_198384 Rosetta Predictions human pricing
NM_198385 Rosetta Predictions human pricing
NM_198386 Rosetta Predictions human pricing
NM_198387 Rosetta Predictions human pricing
NM_198388 Rosetta Predictions human pricing
NM_198396 Rosetta Predictions human pricing
NM_198397 Rosetta Predictions human pricing
NM_031601 Rosetta Predictions rat pricing
XM_579518 Rosetta Predictions rat pricing
NM_001112813 Rosetta Predictions mouse pricing
NM_009783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160685 predicted 4323
2 SASI_Hs01_00160686 predicted 1303
3 SASI_Hs01_00160688 predicted 1464
4 SASI_Hs01_00160690 predicted 938
5 SASI_Hs01_00160694 predicted 4181
6 SASI_Hs01_00160691 predicted 4134
7 SASI_Hs01_00160692 predicted 742
8 SASI_Hs01_00160689 predicted 1140
9 SASI_Hs01_00160693 predicted 2286
10 SASI_Hs02_00352320 predicted 5410
11 SASI_Hs01_00160687 predicted 2793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195776 predicted 4249
2 SASI_Hs01_00195777 predicted 1307
3 SASI_Hs01_00195779 predicted 1458
4 SASI_Hs01_00195781 predicted 937
5 SASI_Hs01_00195785 predicted 4106
6 SASI_Hs01_00195782 predicted 4066
7 SASI_Hs01_00195783 predicted 739
8 SASI_Hs01_00195780 predicted 1137
9 SASI_Hs01_00195784 predicted 2282
10 SASI_Hs02_00371889 predicted 5309
11 SASI_Hs01_00195778 predicted 2791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041477 predicted 4249
2 SASI_Hs01_00041478 predicted 1303
3 SASI_Hs01_00041480 predicted 1464
4 SASI_Hs01_00041482 predicted 931
5 SASI_Hs01_00041486 predicted 4105
6 SASI_Hs01_00041483 predicted 4066
7 SASI_Hs01_00041484 predicted 743
8 SASI_Hs01_00041481 predicted 1140
9 SASI_Hs01_00041485 predicted 2288
10 SASI_Hs02_00371890 predicted 5340
11 SASI_Hs01_00041479 predicted 2795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104457 predicted 4325
2 SASI_Hs01_00104458 predicted 1303
3 SASI_Hs01_00104460 predicted 1460
4 SASI_Hs01_00104462 predicted 935
5 SASI_Hs01_00104466 predicted 4183
6 SASI_Hs01_00104463 predicted 4129
7 SASI_Hs01_00104464 predicted 745
8 SASI_Hs01_00104461 predicted 1132
9 SASI_Hs01_00104465 predicted 2286
10 SASI_Hs02_00371891 predicted 5371
11 SASI_Hs01_00104459 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150675 predicted 4253
2 SASI_Hs01_00150676 predicted 1301
3 SASI_Hs01_00150678 predicted 1466
4 SASI_Hs01_00150680 predicted 938
5 SASI_Hs01_00150684 predicted 4113
6 SASI_Hs01_00150681 predicted 4062
7 SASI_Hs01_00150682 predicted 740
8 SASI_Hs01_00150679 predicted 1138
9 SASI_Hs01_00150683 predicted 2282
10 SASI_Hs02_00371892 predicted 5310
11 SASI_Hs01_00150677 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238405 predicted 4327
2 SASI_Hs01_00238406 predicted 1305
3 SASI_Hs01_00238408 predicted 1462
4 SASI_Hs01_00238410 predicted 930
5 SASI_Hs01_00238414 predicted 4179
6 SASI_Hs01_00238411 predicted 4130
7 SASI_Hs01_00238412 predicted 747
8 SASI_Hs01_00238409 predicted 1136
9 SASI_Hs01_00238413 predicted 2280
10 SASI_Hs02_00371893 predicted 5378
11 SASI_Hs01_00238407 predicted 2797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172836 predicted 4252
2 SASI_Hs01_00172837 predicted 1307
3 SASI_Hs01_00172839 predicted 1463
4 SASI_Hs01_00172841 predicted 932
5 SASI_Hs01_00172845 predicted 4114
6 SASI_Hs01_00172842 predicted 4064
7 SASI_Hs01_00172843 predicted 744
8 SASI_Hs01_00172840 predicted 1140
9 SASI_Hs01_00172844 predicted 2284
10 SASI_Hs02_00371896 predicted 5341
11 SASI_Hs01_00172838 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131167 predicted 4250
2 SASI_Hs01_00131168 predicted 1305
3 SASI_Hs01_00131170 predicted 1465
4 SASI_Hs01_00131172 predicted 935
5 SASI_Hs01_00131176 predicted 4108
6 SASI_Hs01_00131173 predicted 4068
7 SASI_Hs01_00131174 predicted 748
8 SASI_Hs01_00131171 predicted 1135
9 SASI_Hs01_00131175 predicted 2285
10 SASI_Hs02_00371897 predicted 5341
11 SASI_Hs01_00131169 predicted 2801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204998 predicted 4324
2 SASI_Hs01_00204999 predicted 1304
3 SASI_Hs01_00205001 predicted 1458
4 SASI_Hs01_00205003 predicted 931
5 SASI_Hs01_00205007 predicted 4175
6 SASI_Hs01_00205004 predicted 4130
7 SASI_Hs01_00205005 predicted 746
8 SASI_Hs01_00205002 predicted 1140
9 SASI_Hs01_00205006 predicted 2282
10 SASI_Hs02_00371898 predicted 5405
11 SASI_Hs01_00205000 predicted 2792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068659 predicted 4324
2 SASI_Hs01_00068660 predicted 1301
3 SASI_Hs01_00068662 predicted 1467
4 SASI_Hs01_00068664 predicted 932
5 SASI_Hs01_00068668 predicted 4183
6 SASI_Hs01_00068665 predicted 4130
7 SASI_Hs01_00068666 predicted 748
8 SASI_Hs01_00068663 predicted 1133
9 SASI_Hs01_00068667 predicted 2286
10 SASI_Hs02_00371899 predicted 5412
11 SASI_Hs01_00068661 predicted 2794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013664 predicted 4319
2 SASI_Hs01_00013665 predicted 1309
3 SASI_Hs01_00013667 predicted 1462
4 SASI_Hs01_00013669 predicted 938
5 SASI_Hs01_00013673 predicted 4180
6 SASI_Hs01_00013670 predicted 4130
7 SASI_Hs01_00013671 predicted 743
8 SASI_Hs01_00013668 predicted 1132
9 SASI_Hs01_00013672 predicted 2282
10 SASI_Hs02_00371900 predicted 5359
11 SASI_Hs01_00013666 predicted 2793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057859 predicted 4254
2 SASI_Hs01_00057860 predicted 1304
3 SASI_Hs01_00057862 predicted 1459
4 SASI_Hs01_00057864 predicted 938
5 SASI_Hs01_00057868 predicted 4111
6 SASI_Hs01_00057865 predicted 4063
7 SASI_Hs01_00057866 predicted 747
8 SASI_Hs01_00057863 predicted 1132
9 SASI_Hs01_00057867 predicted 2280
10 SASI_Hs02_00371901 predicted 5309
11 SASI_Hs01_00057861 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179085 predicted 4249
2 SASI_Hs01_00179086 predicted 1308
3 SASI_Hs01_00179088 predicted 1464
4 SASI_Hs01_00179090 predicted 938
5 SASI_Hs01_00179094 predicted 4112
6 SASI_Hs01_00179091 predicted 4068
7 SASI_Hs01_00179092 predicted 742
8 SASI_Hs01_00179089 predicted 1141
9 SASI_Hs01_00179093 predicted 2283
10 SASI_Hs02_00371902 predicted 5286
11 SASI_Hs01_00179087 predicted 2795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103556 predicted 4251
2 SASI_Hs01_00103557 predicted 1309
3 SASI_Hs01_00103559 predicted 1459
4 SASI_Hs01_00103561 predicted 939
5 SASI_Hs01_00103565 predicted 4112
6 SASI_Hs01_00103562 predicted 4063
7 SASI_Hs01_00103563 predicted 739
8 SASI_Hs01_00103560 predicted 1136
9 SASI_Hs01_00103564 predicted 2285
10 SASI_Hs02_00371914 predicted 5302
11 SASI_Hs01_00103558 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041717 predicted 4326
2 SASI_Hs01_00041718 predicted 1300
3 SASI_Hs01_00041720 predicted 1462
4 SASI_Hs01_00041722 predicted 933
5 SASI_Hs01_00041726 predicted 4182
6 SASI_Hs01_00041723 predicted 4137
7 SASI_Hs01_00041724 predicted 746
8 SASI_Hs01_00041721 predicted 1140
9 SASI_Hs01_00041725 predicted 2286
10 SASI_Hs02_00371915 predicted 628
11 SASI_Hs01_00041719 predicted 2792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068313 predicted 733
2 SASI_Rn01_00068314 predicted 5779
3 SASI_Rn01_00068315 predicted 5313
4 SASI_Rn01_00068316 predicted 5865
5 SASI_Rn02_00264880 predicted 6907
6 SASI_Rn02_00264881 predicted 3653
7 SASI_Rn01_00068317 predicted 4225
8 SASI_Rn01_00068318 predicted 6393
9 SASI_Rn01_00068319 predicted 1392
10 SASI_Rn01_00068320 predicted 2883
11 SASI_Rn01_00068321 predicted 1055
12 SASI_Rn01_00068322 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177715 predicted 747
2 SASI_Rn01_00177716 predicted 5788
3 SASI_Rn01_00177717 predicted 4177
4 SASI_Rn01_00177718 predicted 4238
5 SASI_Rn01_00177719 predicted 2891
6 SASI_Rn01_00177720 predicted 4178
7 SASI_Rn01_00177721 predicted 1561
8 SASI_Rn01_00177722 predicted 4381
9 SASI_Rn01_00177723 predicted 4192
10 SASI_Rn01_00177724 predicted 4401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307133 predicted 2490
2 SASI_Mm02_00307134 predicted 3596
3 SASI_Mm02_00307135 predicted 2816
4 SASI_Mm02_00307136 predicted 1328
5 SASI_Mm02_00307137 predicted 5775
6 SASI_Mm02_00307138 predicted 4099
7 SASI_Mm02_00307139 predicted 5446
8 SASI_Mm02_00307140 predicted 5311
9 SASI_Mm02_00307141 predicted 5071
10 SASI_Mm02_00307142 predicted 6114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119118 predicted 2493
2 SASI_Mm01_00119119 predicted 3664
3 SASI_Mm01_00119120 predicted 2818
4 SASI_Mm02_00317016 predicted 1324
5 SASI_Mm01_00119121 predicted 5839
6 SASI_Mm01_00119122 predicted 4166
7 SASI_Mm01_00119123 predicted 5516
8 SASI_Mm01_00119124 predicted 5371
9 SASI_Mm01_00119125 predicted 5141
10 SASI_Mm02_00317017 predicted 6178
11 SASI_Mm01_00119126 predicted 5179
12 SASI_Mm01_00119127 predicted 2929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018896
CACNA1G MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, T type, alpha 1G subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018896.3-7558s21c1
Sequence:CCGGCTCCTCCTCCTGGGCTATATTCTCGAGAATATAGCCCAGGAGGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018896.3-3367s21c1
Sequence:CCGGTCCGAATCAGAGCCCGATTTCCTCGAGGAAATCGGGCTCTGATTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018896.3-7457s21c1
Sequence:CCGGTGCTGAGTCTCTCCGGTTTATCTCGAGATAAACCGGAGAGACTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-1372s1c1
Sequence:CCGGGCCATCAACTTTGACAACATTCTCGAGAATGTTGTCAAAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-5853s1c1
Sequence:CCGGGCCTATCTACTTTGTGTCCTTCTCGAGAAGGACACAAAGTAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-4764s1c1
Sequence:CCGGGCACAAGTACAACTTTGACAACTCGAGTTGTCAAAGTTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-2691s1c1
Sequence:CCGGCGCCCTAGAAATCAGCAACATCTCGAGATGTTGCTGATTTCTAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-727s1c1
Sequence:CCGGGCCTTTGATGACTTCATCTTTCTCGAGAAAGATGAAGTCATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018896
CACNA1G MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, T type, alpha 1G subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018896.3-7558s21c1
Sequence:CCGGCTCCTCCTCCTGGGCTATATTCTCGAGAATATAGCCCAGGAGGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018896.3-3367s21c1
Sequence:CCGGTCCGAATCAGAGCCCGATTTCCTCGAGGAAATCGGGCTCTGATTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018896.3-7457s21c1
Sequence:CCGGTGCTGAGTCTCTCCGGTTTATCTCGAGATAAACCGGAGAGACTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-1372s1c1
Sequence:CCGGGCCATCAACTTTGACAACATTCTCGAGAATGTTGTCAAAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-5853s1c1
Sequence:CCGGGCCTATCTACTTTGTGTCCTTCTCGAGAAGGACACAAAGTAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-4764s1c1
Sequence:CCGGGCACAAGTACAACTTTGACAACTCGAGTTGTCAAAGTTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-2691s1c1
Sequence:CCGGCGCCCTAGAAATCAGCAACATCTCGAGATGTTGCTGATTTCTAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-727s1c1
Sequence:CCGGGCCTTTGATGACTTCATCTTTCTCGAGAAAGATGAAGTCATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018896
CACNA1G MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, T type, alpha 1G subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018896.3-7558s21c1
Sequence:CCGGCTCCTCCTCCTGGGCTATATTCTCGAGAATATAGCCCAGGAGGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018896.3-3367s21c1
Sequence:CCGGTCCGAATCAGAGCCCGATTTCCTCGAGGAAATCGGGCTCTGATTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018896.3-7457s21c1
Sequence:CCGGTGCTGAGTCTCTCCGGTTTATCTCGAGATAAACCGGAGAGACTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-1372s1c1
Sequence:CCGGGCCATCAACTTTGACAACATTCTCGAGAATGTTGTCAAAGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-5853s1c1
Sequence:CCGGGCCTATCTACTTTGTGTCCTTCTCGAGAAGGACACAAAGTAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-4764s1c1
Sequence:CCGGGCACAAGTACAACTTTGACAACTCGAGTTGTCAAAGTTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-2691s1c1
Sequence:CCGGCGCCCTAGAAATCAGCAACATCTCGAGATGTTGCTGATTTCTAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018896.3-727s1c1
Sequence:CCGGGCCTTTGATGACTTCATCTTTCTCGAGAAAGATGAAGTCATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009783
VALIDATED
CACNA1G MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, T type, alpha 1G subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-2670s21c1
Sequence:CCGGGATCGCTATCCTGGTCAATACCTCGAGGTATTGACCAGGATAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009783.2-7653s21c1
Sequence:CCGGTATGCTGGATGTACGACATTTCTCGAGAAATGTCGTACATCCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-4177s21c1
Sequence:CCGGGATTCCTGGTCTGCCTATATCCTCGAGGATATAGGCAGACCAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-1009s21c1
Sequence:CCGGATGCGCATTCTCGTCACATTACTCGAGTAATGTGACGAGAATGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-1657s21c1
Sequence:CCGGCGTGTACGATTCCTGTCCAATCTCGAGATTGGACAGGAATCGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-1345s1c1
Sequence:CCGGCGTGTACGATTCCTGTCCAATCTCGAGATTGGACAGGAATCGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-1179s1c1
Sequence:CCGGCGACATCATGTACTTTGTGATCTCGAGATCACAAAGTACATGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-4834s1c1
Sequence:CCGGGCCGATCTAATGTTGGACGATCTCGAGATCGTCCAACATTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009783.1-2317s1c1
Sequence:CCGGCGGAAGATCGTAGATAGCAAACTCGAGTTTGCTATCTACGATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-3194s1c1
Sequence:CCGGCGGAACTACGAAAGAGCCTTTCTCGAGAAAGGCTCTTTCGTAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009783
VALIDATED
CACNA1G MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, T type, alpha 1G subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-2670s21c1
Sequence:CCGGGATCGCTATCCTGGTCAATACCTCGAGGTATTGACCAGGATAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009783.2-7653s21c1
Sequence:CCGGTATGCTGGATGTACGACATTTCTCGAGAAATGTCGTACATCCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-4177s21c1
Sequence:CCGGGATTCCTGGTCTGCCTATATCCTCGAGGATATAGGCAGACCAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-1009s21c1
Sequence:CCGGATGCGCATTCTCGTCACATTACTCGAGTAATGTGACGAGAATGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-1657s21c1
Sequence:CCGGCGTGTACGATTCCTGTCCAATCTCGAGATTGGACAGGAATCGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-1345s1c1
Sequence:CCGGCGTGTACGATTCCTGTCCAATCTCGAGATTGGACAGGAATCGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-1179s1c1
Sequence:CCGGCGACATCATGTACTTTGTGATCTCGAGATCACAAAGTACATGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-4834s1c1
Sequence:CCGGGCCGATCTAATGTTGGACGATCTCGAGATCGTCCAACATTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009783.1-2317s1c1
Sequence:CCGGCGGAAGATCGTAGATAGCAAACTCGAGTTTGCTATCTACGATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-3194s1c1
Sequence:CCGGCGGAACTACGAAAGAGCCTTTCTCGAGAAAGGCTCTTTCGTAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009783
VALIDATED
CACNA1G MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, T type, alpha 1G subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-2670s21c1
Sequence:CCGGGATCGCTATCCTGGTCAATACCTCGAGGTATTGACCAGGATAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009783.2-7653s21c1
Sequence:CCGGTATGCTGGATGTACGACATTTCTCGAGAAATGTCGTACATCCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-4177s21c1
Sequence:CCGGGATTCCTGGTCTGCCTATATCCTCGAGGATATAGGCAGACCAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-1009s21c1
Sequence:CCGGATGCGCATTCTCGTCACATTACTCGAGTAATGTGACGAGAATGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009783.2-1657s21c1
Sequence:CCGGCGTGTACGATTCCTGTCCAATCTCGAGATTGGACAGGAATCGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-1345s1c1
Sequence:CCGGCGTGTACGATTCCTGTCCAATCTCGAGATTGGACAGGAATCGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-1179s1c1
Sequence:CCGGCGACATCATGTACTTTGTGATCTCGAGATCACAAAGTACATGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-4834s1c1
Sequence:CCGGGCCGATCTAATGTTGGACGATCTCGAGATCGTCCAACATTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009783.1-2317s1c1
Sequence:CCGGCGGAAGATCGTAGATAGCAAACTCGAGTTTGCTATCTACGATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009783.1-3194s1c1
Sequence:CCGGCGGAACTACGAAAGAGCCTTTCTCGAGAAAGGCTCTTTCGTAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks