EMAIL THIS PAGE TO A FRIEND

CACNA1H

calcium channel, voltage-dependent, T type, alpha 1H subunit

61 Gene Product Result for
Synonyms: CACNA1HB Cav3.2 ECA6 EIG6
Gene ID:
Human(8912) Summary: This gene encodes a T-type member of the alpha-1 subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Alternate transcriptional splice variants, encoding different isoforms, have been characterized for the gene described here. Studies suggest certain mutations in this gene lead to childhood absence epilepsy (CAE). [provided by RefSeq, Jul 2008]
Mouse(58226) calcium channel, voltage-dependent, T type, alpha 1H subunit
Rat(114862) calcium channel, voltage-dependent, T type, alpha 1H subunit
chicken(416526) calcium channel, voltage-dependent, T type, alpha 1H subunit
dog(403533) calcium channel, voltage-dependent, T type, alpha 1H subunit
cow(282412) calcium channel, voltage-dependent, T type, alpha 1H subunit
domestic cat(101090071) calcium channel, voltage-dependent, T type, alpha 1H subunit
domestic guinea pig(100720102) calcium channel, voltage-dependent, T type, alpha 1H subunit
naked mole-rat(101712631) calcium channel, voltage-dependent, T type, alpha 1H subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
K1514 Kurtoxin human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005407 Rosetta Predictions human pricing
NM_021098 Rosetta Predictions human pricing
NM_153814 Rosetta Predictions rat pricing
NM_021415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232757 predicted 1253
2 SASI_Hs01_00232758 predicted 2702
3 SASI_Hs01_00232759 predicted 2798
4 SASI_Hs01_00232760 predicted 4122
5 SASI_Hs01_00232762 predicted 4082
6 SASI_Hs01_00232763 predicted 4251
7 SASI_Hs01_00232764 predicted 5230
8 SASI_Hs01_00232765 predicted 1391
9 SASI_Hs01_00232766 predicted 7096
10 SASI_Hs01_00232761 predicted 3374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212471 predicted 1253
2 SASI_Hs01_00212472 predicted 2703
3 SASI_Hs01_00212473 predicted 2797
4 SASI_Hs01_00212474 predicted 4118
5 SASI_Hs01_00212476 predicted 4075
6 SASI_Hs01_00212477 predicted 4248
7 SASI_Hs01_00212478 predicted 5253
8 SASI_Hs01_00212479 predicted 1389
9 SASI_Hs01_00212480 predicted 7117
10 SASI_Hs01_00212475 predicted 3381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107845 predicted 5031
2 SASI_Rn01_00107846 predicted 3025
3 SASI_Rn02_00269040 predicted 1295
4 SASI_Rn01_00107847 predicted 2153
5 SASI_Rn01_00107848 predicted 4574
6 SASI_Rn01_00107850 predicted 3477
7 SASI_Rn01_00107851 predicted 5182
8 SASI_Rn01_00107852 predicted 6842
9 SASI_Rn01_00107854 predicted 1869
10 SASI_Rn02_00269041 predicted 3151
11 SASI_Rn01_00107849 predicted 4122
12 SASI_Rn01_00107853 predicted 3826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326050 predicted 7280
2 SASI_Mm01_00032353 predicted 5278
3 SASI_Mm01_00032354 predicted 3227
4 SASI_Mm01_00032355 predicted 5777
5 SASI_Mm01_00032356 predicted 4297
6 SASI_Mm01_00032357 predicted 995
7 SASI_Mm01_00032358 predicted 3402
8 SASI_Mm01_00032359 predicted 5632
9 SASI_Mm01_00032360 predicted 866
10 SASI_Mm01_00032361 predicted 1457
11 SASI_Mm01_00032362 predicted 3770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021415
CACNA1H MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, T type, alpha 1H subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021415.2-7302s1c1
Sequence:CCGGGTGGTGATTCAGGTTTGGGTTCTCGAGAACCCAAACCTGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-2400s1c1
Sequence:CCGGCCTCGTCAATACTCTGAGCATCTCGAGATGCTCAGAGTATTGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-5352s1c1
Sequence:CCGGGCTAGAATGCAGCGAGGATAACTCGAGTTATCCTCGCTGCATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-1170s1c1
Sequence:CCGGCCACTCGTTCTACAACTTCATCTCGAGATGAAGTTGTAGAACGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-6943s1c1
Sequence:CCGGCCTCTAATACTAGAAACTGAACTCGAGTTCAGTTTCTAGTATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5281s21c1
Sequence:GTACCGGAGTACTGCAACTACGTCTTTACTCGAGTAAAGACGTAGTTGCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021415.3-7819s21c1
Sequence:CCGGTGTAGCCGCCACAACCCATATCTCGAGATATGGGTTGTGGCGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-7231s21c1
Sequence:CCGGGGGCTATAGTGCCTCTAATACCTCGAGGTATTAGAGGCACTATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5695s21c1
Sequence:CCGGACGCCACCTTCACCAACTTTGCTCGAGCAAAGTTGGTGAAGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5652s21c1
Sequence:CCGGCTAGAATGCAGCGAGGATAATCTCGAGATTATCCTCGCTGCATTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021415
CACNA1H MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, T type, alpha 1H subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021415.2-7302s1c1
Sequence:CCGGGTGGTGATTCAGGTTTGGGTTCTCGAGAACCCAAACCTGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-2400s1c1
Sequence:CCGGCCTCGTCAATACTCTGAGCATCTCGAGATGCTCAGAGTATTGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-5352s1c1
Sequence:CCGGGCTAGAATGCAGCGAGGATAACTCGAGTTATCCTCGCTGCATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-1170s1c1
Sequence:CCGGCCACTCGTTCTACAACTTCATCTCGAGATGAAGTTGTAGAACGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-6943s1c1
Sequence:CCGGCCTCTAATACTAGAAACTGAACTCGAGTTCAGTTTCTAGTATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5281s21c1
Sequence:GTACCGGAGTACTGCAACTACGTCTTTACTCGAGTAAAGACGTAGTTGCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021415.3-7819s21c1
Sequence:CCGGTGTAGCCGCCACAACCCATATCTCGAGATATGGGTTGTGGCGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-7231s21c1
Sequence:CCGGGGGCTATAGTGCCTCTAATACCTCGAGGTATTAGAGGCACTATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5695s21c1
Sequence:CCGGACGCCACCTTCACCAACTTTGCTCGAGCAAAGTTGGTGAAGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5652s21c1
Sequence:CCGGCTAGAATGCAGCGAGGATAATCTCGAGATTATCCTCGCTGCATTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021415
CACNA1H MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, T type, alpha 1H subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021415.2-7302s1c1
Sequence:CCGGGTGGTGATTCAGGTTTGGGTTCTCGAGAACCCAAACCTGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-2400s1c1
Sequence:CCGGCCTCGTCAATACTCTGAGCATCTCGAGATGCTCAGAGTATTGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-5352s1c1
Sequence:CCGGGCTAGAATGCAGCGAGGATAACTCGAGTTATCCTCGCTGCATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-1170s1c1
Sequence:CCGGCCACTCGTTCTACAACTTCATCTCGAGATGAAGTTGTAGAACGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021415.2-6943s1c1
Sequence:CCGGCCTCTAATACTAGAAACTGAACTCGAGTTCAGTTTCTAGTATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5281s21c1
Sequence:GTACCGGAGTACTGCAACTACGTCTTTACTCGAGTAAAGACGTAGTTGCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021415.3-7819s21c1
Sequence:CCGGTGTAGCCGCCACAACCCATATCTCGAGATATGGGTTGTGGCGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-7231s21c1
Sequence:CCGGGGGCTATAGTGCCTCTAATACCTCGAGGTATTAGAGGCACTATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5695s21c1
Sequence:CCGGACGCCACCTTCACCAACTTTGCTCGAGCAAAGTTGGTGAAGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021415.3-5652s21c1
Sequence:CCGGCTAGAATGCAGCGAGGATAATCTCGAGATTATCCTCGCTGCATTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021098
VALIDATED
CACNA1H MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, T type, alpha 1H subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-5241s1c1
Sequence:CCGGGCACTGAAGCTGGTAGCATTTCTCGAGAAATGCTACCAGCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-1643s1c1
Sequence:CCGGCCACATATTCCGCAAGGTCAACTCGAGTTGACCTTGCGGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-2708s1c1
Sequence:CCGGGCTGACTAATGCTCTGGAGATCTCGAGATCTCCAGAGCATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-5756s1c1
Sequence:CCGGGCCCGTCTACTTCGTGACCTTCTCGAGAAGGTCACGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-4229s1c1
Sequence:CCGGCCTCAGCGTCTCCAATTACATCTCGAGATGTAATTGGAGACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-5209s21c1
Sequence:CCGGACGTCTTCACCATCGTGTTTGCTCGAGCAAACACGATGGTGAAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021098.2-7506s21c1
Sequence:CCGGTCCGTTCTGGTTCGGGTTTCTCTCGAGAGAAACCCGAACCAGAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-4229s21c1
Sequence:CCGGCCTCAGCGTCTCCAATTACATCTCGAGATGTAATTGGAGACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-1643s21c1
Sequence:CCGGCCACATATTCCGCAAGGTCAACTCGAGTTGACCTTGCGGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-5756s21c1
Sequence:CCGGGCCCGTCTACTTCGTGACCTTCTCGAGAAGGTCACGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021098
VALIDATED
CACNA1H MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, T type, alpha 1H subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-5241s1c1
Sequence:CCGGGCACTGAAGCTGGTAGCATTTCTCGAGAAATGCTACCAGCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-1643s1c1
Sequence:CCGGCCACATATTCCGCAAGGTCAACTCGAGTTGACCTTGCGGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-2708s1c1
Sequence:CCGGGCTGACTAATGCTCTGGAGATCTCGAGATCTCCAGAGCATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-5756s1c1
Sequence:CCGGGCCCGTCTACTTCGTGACCTTCTCGAGAAGGTCACGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-4229s1c1
Sequence:CCGGCCTCAGCGTCTCCAATTACATCTCGAGATGTAATTGGAGACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-5209s21c1
Sequence:CCGGACGTCTTCACCATCGTGTTTGCTCGAGCAAACACGATGGTGAAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021098.2-7506s21c1
Sequence:CCGGTCCGTTCTGGTTCGGGTTTCTCTCGAGAGAAACCCGAACCAGAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-4229s21c1
Sequence:CCGGCCTCAGCGTCTCCAATTACATCTCGAGATGTAATTGGAGACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-1643s21c1
Sequence:CCGGCCACATATTCCGCAAGGTCAACTCGAGTTGACCTTGCGGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-5756s21c1
Sequence:CCGGGCCCGTCTACTTCGTGACCTTCTCGAGAAGGTCACGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021098
VALIDATED
CACNA1H MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, T type, alpha 1H subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-5241s1c1
Sequence:CCGGGCACTGAAGCTGGTAGCATTTCTCGAGAAATGCTACCAGCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-1643s1c1
Sequence:CCGGCCACATATTCCGCAAGGTCAACTCGAGTTGACCTTGCGGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-2708s1c1
Sequence:CCGGGCTGACTAATGCTCTGGAGATCTCGAGATCTCCAGAGCATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-5756s1c1
Sequence:CCGGGCCCGTCTACTTCGTGACCTTCTCGAGAAGGTCACGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021098.1-4229s1c1
Sequence:CCGGCCTCAGCGTCTCCAATTACATCTCGAGATGTAATTGGAGACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-5209s21c1
Sequence:CCGGACGTCTTCACCATCGTGTTTGCTCGAGCAAACACGATGGTGAAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021098.2-7506s21c1
Sequence:CCGGTCCGTTCTGGTTCGGGTTTCTCTCGAGAGAAACCCGAACCAGAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-4229s21c1
Sequence:CCGGCCTCAGCGTCTCCAATTACATCTCGAGATGTAATTGGAGACGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-1643s21c1
Sequence:CCGGCCACATATTCCGCAAGGTCAACTCGAGTTGACCTTGCGGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021098.2-5756s21c1
Sequence:CCGGGCCCGTCTACTTCGTGACCTTCTCGAGAAGGTCACGAAGTAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks