EMAIL THIS PAGE TO A FRIEND

CACNA1I

calcium channel, voltage-dependent, T type, alpha 1I subunit

70 Gene Product Result for
Synonyms: Cav3.3 ca(v)3.3
Gene ID:
Human(8911) Summary: This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Mouse(239556) calcium channel, voltage-dependent, alpha 1I subunit
Rat(56827) calcium channel, voltage-dependent, T type, alpha 1I subunit
naked mole-rat(101723335) calcium channel, voltage-dependent, T type, alpha 1I subunit
domestic guinea pig(100735927) calcium channel, voltage-dependent, T type, alpha 1I subunit
sheep(101123461) calcium channel, voltage-dependent, T type, alpha 1I subunit
Zebrafish(566351) calcium channel, voltage-dependent, T type, alpha 1I subunit
chicken(427900) calcium channel, voltage-dependent, T type, alpha 1I subunit
cow(282413) calcium channel, voltage-dependent, T type, alpha 1I subunit
domestic cat(101097569) calcium channel, voltage-dependent, T type, alpha 1I subunit
dog(481243) calcium channel, voltage-dependent, T type, alpha 1I subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
K1514 Kurtoxin human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021096 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001044308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001044308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001044308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_139476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU186271 MISSION® esiRNA esiRNA targeting mouse Cacna1i mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003406 Rosetta Predictions human pricing
NM_021096 Rosetta Predictions human pricing
NM_020084 Rosetta Predictions rat pricing
NM_001044308 Rosetta Predictions mouse pricing
XM_139476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136982 predicted 1029
2 SASI_Hs01_00136983 predicted 1028
3 SASI_Hs01_00136984 predicted 4505
4 SASI_Hs01_00136985 predicted 1129
5 SASI_Hs01_00136986 predicted 3386
6 SASI_Hs01_00136987 predicted 208
7 SASI_Hs01_00136988 predicted 1967
8 SASI_Hs01_00136989 predicted 4054
9 SASI_Hs01_00136990 predicted 2220
10 SASI_Hs01_00136991 predicted 5698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016285 predicted 1036
2 SASI_Hs01_00016286 predicted 1028
3 SASI_Hs01_00016287 predicted 4611
4 SASI_Hs01_00016288 predicted 1129
5 SASI_Hs01_00016289 predicted 3485
6 SASI_Hs01_00016290 predicted 209
7 SASI_Hs01_00016291 predicted 2070
8 SASI_Hs01_00016292 predicted 4158
9 SASI_Hs01_00016293 predicted 2323
10 SASI_Hs01_00016294 predicted 5807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110723 predicted 204
2 SASI_Rn01_00110724 predicted 875
3 SASI_Rn01_00110725 predicted 4906
4 SASI_Rn01_00110726 predicted 1292
5 SASI_Rn01_00110727 predicted 4491
6 SASI_Rn01_00110729 predicted 1800
7 SASI_Rn01_00110730 predicted 3893
8 SASI_Rn01_00110731 predicted 3452
9 SASI_Rn01_00110732 predicted 4019
10 SASI_Rn02_00262492 predicted 4540
11 SASI_Rn01_00110728 predicted 3641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291214 predicted 763
2 SASI_Mm02_00291215 predicted 4115
3 SASI_Mm02_00291216 predicted 3307
4 SASI_Mm02_00291217 predicted 2374
5 SASI_Mm02_00291218 predicted 3923
6 SASI_Mm02_00291219 predicted 5466
7 SASI_Mm02_00291220 predicted 2768
8 SASI_Mm02_00291221 predicted 882
9 SASI_Mm02_00291222 predicted 4427
10 SASI_Mm02_00291223 predicted 2363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207910 predicted 851
2 SASI_Mm01_00207911 predicted 4202
3 SASI_Mm01_00207912 predicted 3392
4 SASI_Mm01_00207913 predicted 2459
5 SASI_Mm01_00207914 predicted 4012
6 SASI_Mm01_00207915 predicted 5546
7 SASI_Mm01_00207916 predicted 2853
8 SASI_Mm01_00207917 predicted 969
9 SASI_Mm01_00207918 predicted 4514
10 SASI_Mm01_00207919 predicted 5297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021096
CACNA1I MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, T type, alpha 1I subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-4401s21c1
Sequence:CCGGGCCCTACTATGCCACCTATTGCTCGAGCAATAGGTGGCATAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-1016s21c1
Sequence:CCGGACTTTGACAACATCGGTTATGCTCGAGCATAACCGATGTTGTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-890s21c1
Sequence:CCGGAGGACGACGTCTACGACTTTGCTCGAGCAAAGTCGTAGACGTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-724s1c1
Sequence:CCGGGAGGAGAACTTCACCATACAACTCGAGTTGTATGGTGAAGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-3391s1c1
Sequence:CCGGCGCAAGATGATCGACGTCTATCTCGAGATAGACGTCGATCATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-4702s1c1
Sequence:CCGGCTGGAGGAGATCGAGATCAATCTCGAGATTGATCTCGATCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-5412s1c1
Sequence:CCGGCAGCGTCTCTTTAATCATCAACTCGAGTTGATGATTAAAGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-237s1c1
Sequence:CCGGGTGGTTTGAATGTGTCAGCATCTCGAGATGCTGACACATTCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021096
CACNA1I MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, T type, alpha 1I subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-4401s21c1
Sequence:CCGGGCCCTACTATGCCACCTATTGCTCGAGCAATAGGTGGCATAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-1016s21c1
Sequence:CCGGACTTTGACAACATCGGTTATGCTCGAGCATAACCGATGTTGTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-890s21c1
Sequence:CCGGAGGACGACGTCTACGACTTTGCTCGAGCAAAGTCGTAGACGTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-724s1c1
Sequence:CCGGGAGGAGAACTTCACCATACAACTCGAGTTGTATGGTGAAGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-3391s1c1
Sequence:CCGGCGCAAGATGATCGACGTCTATCTCGAGATAGACGTCGATCATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-4702s1c1
Sequence:CCGGCTGGAGGAGATCGAGATCAATCTCGAGATTGATCTCGATCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-5412s1c1
Sequence:CCGGCAGCGTCTCTTTAATCATCAACTCGAGTTGATGATTAAAGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-237s1c1
Sequence:CCGGGTGGTTTGAATGTGTCAGCATCTCGAGATGCTGACACATTCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021096
CACNA1I MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, T type, alpha 1I subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-4401s21c1
Sequence:CCGGGCCCTACTATGCCACCTATTGCTCGAGCAATAGGTGGCATAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-1016s21c1
Sequence:CCGGACTTTGACAACATCGGTTATGCTCGAGCATAACCGATGTTGTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021096.3-890s21c1
Sequence:CCGGAGGACGACGTCTACGACTTTGCTCGAGCAAAGTCGTAGACGTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-724s1c1
Sequence:CCGGGAGGAGAACTTCACCATACAACTCGAGTTGTATGGTGAAGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-3391s1c1
Sequence:CCGGCGCAAGATGATCGACGTCTATCTCGAGATAGACGTCGATCATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-4702s1c1
Sequence:CCGGCTGGAGGAGATCGAGATCAATCTCGAGATTGATCTCGATCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-5412s1c1
Sequence:CCGGCAGCGTCTCTTTAATCATCAACTCGAGTTGATGATTAAAGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021096.2-237s1c1
Sequence:CCGGGTGGTTTGAATGTGTCAGCATCTCGAGATGCTGACACATTCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001044308
CACNA1I MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, T type, alpha 1I subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-5194s21c1
Sequence:CCGGATCATGCGTGTTCTGCGTATTCTCGAGAATACGCAGAACACGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-3919s21c1
Sequence:CCGGATCCTGTGTCAGACCATTATTCTCGAGAATAATGGTCTGACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-850s21c1
Sequence:CCGGTACCAGCCATGTGACGATATGCTCGAGCATATCGTCACATGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-3316s21c1
Sequence:CCGGAGCTATGATCAGCGATCTTTGCTCGAGCAAAGATCGCTGATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044308.2-9052s21c1
Sequence:CCGGCCTGGTAAGATGAGCTATAAACTCGAGTTTATAGCTCATCTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001044308
CACNA1I MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, T type, alpha 1I subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-5194s21c1
Sequence:CCGGATCATGCGTGTTCTGCGTATTCTCGAGAATACGCAGAACACGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-3919s21c1
Sequence:CCGGATCCTGTGTCAGACCATTATTCTCGAGAATAATGGTCTGACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-850s21c1
Sequence:CCGGTACCAGCCATGTGACGATATGCTCGAGCATATCGTCACATGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-3316s21c1
Sequence:CCGGAGCTATGATCAGCGATCTTTGCTCGAGCAAAGATCGCTGATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044308.2-9052s21c1
Sequence:CCGGCCTGGTAAGATGAGCTATAAACTCGAGTTTATAGCTCATCTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001044308
CACNA1I MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, T type, alpha 1I subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-5194s21c1
Sequence:CCGGATCATGCGTGTTCTGCGTATTCTCGAGAATACGCAGAACACGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-3919s21c1
Sequence:CCGGATCCTGTGTCAGACCATTATTCTCGAGAATAATGGTCTGACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-850s21c1
Sequence:CCGGTACCAGCCATGTGACGATATGCTCGAGCATATCGTCACATGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044308.2-3316s21c1
Sequence:CCGGAGCTATGATCAGCGATCTTTGCTCGAGCAAAGATCGCTGATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001044308.2-9052s21c1
Sequence:CCGGCCTGGTAAGATGAGCTATAAACTCGAGTTTATAGCTCATCTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139476
VALIDATED
CACNA1I MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, T type, alpha 1I subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-32s1c1
Sequence:CCGGGCAACAAACAAGAATGGTCATCTCGAGATGACCATTCTTGTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-5445s1c1
Sequence:CCGGCCTCACGGTGTCTAACTACATCTCGAGATGTAGTTAGACACCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139476.2-180s1c1
Sequence:CCGGCTGGGTGAACATCATGTATAACTCGAGTTATACATGATGTTCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-4447s1c1
Sequence:CCGGCCAATACCCATGACACCCAATCTCGAGATTGGGTGTCATGGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-5226s1c1
Sequence:CCGGCCGCAAGATGATTGATGTGTACTCGAGTACACATCAATCATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139476
VALIDATED
CACNA1I MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, T type, alpha 1I subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-32s1c1
Sequence:CCGGGCAACAAACAAGAATGGTCATCTCGAGATGACCATTCTTGTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-5445s1c1
Sequence:CCGGCCTCACGGTGTCTAACTACATCTCGAGATGTAGTTAGACACCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139476.2-180s1c1
Sequence:CCGGCTGGGTGAACATCATGTATAACTCGAGTTATACATGATGTTCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-4447s1c1
Sequence:CCGGCCAATACCCATGACACCCAATCTCGAGATTGGGTGTCATGGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-5226s1c1
Sequence:CCGGCCGCAAGATGATTGATGTGTACTCGAGTACACATCAATCATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139476
VALIDATED
CACNA1I MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, T type, alpha 1I subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-32s1c1
Sequence:CCGGGCAACAAACAAGAATGGTCATCTCGAGATGACCATTCTTGTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-5445s1c1
Sequence:CCGGCCTCACGGTGTCTAACTACATCTCGAGATGTAGTTAGACACCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139476.2-180s1c1
Sequence:CCGGCTGGGTGAACATCATGTATAACTCGAGTTATACATGATGTTCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-4447s1c1
Sequence:CCGGCCAATACCCATGACACCCAATCTCGAGATTGGGTGTCATGGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139476.2-5226s1c1
Sequence:CCGGCCGCAAGATGATTGATGTGTACTCGAGTACACATCAATCATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks