EMAIL THIS PAGE TO A FRIEND

CACNA2D1

calcium channel, voltage-dependent, alpha 2/delta subunit 1

170 Gene Product Result for
Synonyms: CACNA2 CACNL2A CCHL2A
UniProtKB ID: P54289, Q17R45, Q9UD80, Q9UD81, Q9UD82
Gene ID:
Human(781) Summary: This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(12293) calcium channel, voltage-dependent, alpha2/delta subunit 1
Rat(25399) calcium channel, voltage-dependent, alpha2/delta subunit 1
chicken(768444) calcium channel, voltage-dependent, alpha 2/delta subunit 1
cow(282608) calcium channel, voltage-dependent, alpha 2/delta subunit 1
domestic cat(101099450) calcium channel, voltage-dependent, alpha 2/delta subunit 1
dog(610342) calcium channel, voltage-dependent, alpha 2/delta subunit 1
naked mole-rat(101708369) calcium channel, voltage-dependent, alpha 2/delta subunit 1
domestic guinea pig(100728887) calcium channel, voltage-dependent, alpha 2/delta subunit 1
sheep(101123550) calcium channel, voltage-dependent, alpha 2/delta subunit 1
Domestic Rabbit(100009105) calcium channel, voltage-dependent, alpha 2/delta subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301195 Anti-CACNA1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2500183 Anti-CACNA2D1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2107922 Anti-CACNA2D1 antibody produced in rabbit affinity isolated antibody rat, guinea pig, pig, human, mouse, rabbit, canine, horse
western blot pricing
HPA008213 Anti-CACNA2D1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA008621 Anti-CACNA2D1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV34952 Anti-CACNA2D1 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, chicken, rabbit, pig, human, canine, rat
western blot pricing
C5105 Anti-Calcium Channel (α2/δ-1 Subunit) antibody produced in rabbit affinity isolated antibody, lyophilized powder pig, mouse, human, rat
western blot pricing
C5613 Anti-Calcium Channel (α2/δSubunit) antibody produced in rabbit ~1 mg/mL, fractionated antiserum, buffered aqueous solution mouse, human, rat
western blot pricing
D219 Monoclonal Anti-Dihydropyridine Receptor (α2 Subunit) antibody produced in mouse clone 20A, ascites fluid, buffered aqueous solution guinea pig, mouse, rabbit, rat
immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing
G154 Gabapentin solid human, rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
F9677 Felodipine solid human pricing
I6658 Isradipine ≥98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000722 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000722 Rosetta Predictions human pricing
NM_001110847 Rosetta Predictions rat pricing
NM_001110848 Rosetta Predictions rat pricing
NM_012919 Rosetta Predictions rat pricing
NM_001110843 Rosetta Predictions mouse pricing
NM_001110844 Rosetta Predictions mouse pricing
NM_001110845 Rosetta Predictions mouse pricing
NM_001110846 Rosetta Predictions mouse pricing
NM_009784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303141 predicted 1799
2 SASI_Hs01_00135469 predicted 3598
3 SASI_Hs01_00135470 predicted 1064
4 SASI_Hs02_00303142 predicted 2796
5 SASI_Hs01_00135471 predicted 2410
6 SASI_Hs02_00303143 predicted 766
7 SASI_Hs01_00135472 predicted 3185
8 SASI_Hs01_00135474 predicted 414
9 SASI_Hs01_00135475 predicted 2752
10 SASI_Hs01_00135476 predicted 1785
11 SASI_Hs01_00135473 predicted 608
12 SASI_Hs01_00135477 predicted 2845
13 SASI_Hs01_00135478 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251402 predicted 355
2 SASI_Rn02_00251403 predicted 373
3 SASI_Rn02_00251404 predicted 692
4 SASI_Rn02_00251405 predicted 995
5 SASI_Rn02_00251406 predicted 215
6 SASI_Rn02_00251407 predicted 799
7 SASI_Rn02_00251408 predicted 647
8 SASI_Rn02_00251409 predicted 2305
9 SASI_Rn02_00251410 predicted 1339
10 SASI_Rn02_00251411 predicted 2483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251412 predicted 351
2 SASI_Rn02_00251413 predicted 357
3 SASI_Rn02_00251414 predicted 681
4 SASI_Rn02_00251415 predicted 989
5 SASI_Rn02_00251416 predicted 212
6 SASI_Rn02_00251417 predicted 791
7 SASI_Rn02_00251418 predicted 640
8 SASI_Rn02_00251419 predicted 2303
9 SASI_Rn02_00251420 predicted 1333
10 SASI_Rn02_00251421 predicted 2492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041085 predicted 633
2 SASI_Rn01_00041086 predicted 646
3 SASI_Rn02_00260456 predicted 966
4 SASI_Rn01_00041087 predicted 1269
5 SASI_Rn01_00041088 predicted 496
6 SASI_Rn02_00260457 predicted 1082
7 SASI_Rn02_00260458 predicted 922
8 SASI_Rn02_00260459 predicted 2614
9 SASI_Rn02_00260460 predicted 1616
10 SASI_Rn02_00260461 predicted 2796
11 SASI_Rn01_00041089 predicted 2878
12 SASI_Rn01_00041090 predicted 2905
13 SASI_Rn01_00041091 predicted 1720
14 SASI_Rn01_00041092 predicted 1829
15 SASI_Rn01_00041093 predicted 1547
16 SASI_Rn01_00041094 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305888 predicted 878
2 SASI_Mm02_00305889 predicted 1311
3 SASI_Mm02_00305890 predicted 1138
4 SASI_Mm02_00305891 predicted 1272
5 SASI_Mm02_00305892 predicted 1373
6 SASI_Mm02_00305893 predicted 1009
7 SASI_Mm02_00305894 predicted 1580
8 SASI_Mm02_00305895 predicted 2684
9 SASI_Mm02_00305896 predicted 3103
10 SASI_Mm02_00305897 predicted 2841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305898 predicted 879
2 SASI_Mm02_00305899 predicted 1306
3 SASI_Mm02_00305900 predicted 1132
4 SASI_Mm02_00305901 predicted 1269
5 SASI_Mm02_00305902 predicted 1366
6 SASI_Mm02_00305903 predicted 1012
7 SASI_Mm02_00305904 predicted 1578
8 SASI_Mm02_00305905 predicted 2647
9 SASI_Mm02_00305906 predicted 3067
10 SASI_Mm02_00305907 predicted 2814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305908 predicted 886
2 SASI_Mm02_00305909 predicted 1310
3 SASI_Mm02_00305910 predicted 1138
4 SASI_Mm02_00305911 predicted 1272
5 SASI_Mm02_00305912 predicted 1374
6 SASI_Mm02_00305913 predicted 1009
7 SASI_Mm02_00305914 predicted 1582
8 SASI_Mm02_00305915 predicted 2633
9 SASI_Mm02_00305916 predicted 3049
10 SASI_Mm02_00305917 predicted 2792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305918 predicted 881
2 SASI_Mm02_00305919 predicted 1314
3 SASI_Mm02_00305920 predicted 1136
4 SASI_Mm02_00305921 predicted 1270
5 SASI_Mm02_00305922 predicted 1370
6 SASI_Mm02_00305923 predicted 1008
7 SASI_Mm02_00305924 predicted 1585
8 SASI_Mm02_00305925 predicted 2616
9 SASI_Mm02_00305926 predicted 3035
10 SASI_Mm02_00305927 predicted 2772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317018 predicted 879
2 SASI_Mm01_00162075 predicted 1309
3 SASI_Mm02_00317019 predicted 1140
4 SASI_Mm02_00317020 predicted 1264
5 SASI_Mm02_00317021 predicted 1370
6 SASI_Mm01_00162079 predicted 1011
7 SASI_Mm01_00162080 predicted 1585
8 SASI_Mm02_00317022 predicted 2633
9 SASI_Mm01_00162082 predicted 3047
10 SASI_Mm01_00162083 predicted 2784
11 SASI_Mm01_00162076 predicted 2160
12 SASI_Mm01_00162077 predicted 1794
13 SASI_Mm01_00162078 predicted 1767
14 SASI_Mm01_00162081 predicted 3201
15 SASI_Mm01_00162084 predicted 1785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009784
CACNA2D1 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009784.2-808s21c1
Sequence:CCGGAGCATGCAGCGGTCCATATTCCTCGAGGAATATGGACCGCTGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009784.2-484s21c1
Sequence:CCGGTGACTCAGCTTGCTGATATTTCTCGAGAAATATCAGCAAGCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009784.1-3603s1c1
Sequence:CCGGCCATGACGTAACTAAGCCTTACTCGAGTAAGGCTTAGTTACGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-1336s1c1
Sequence:CCGGCCCAGGAGATATTTGCCAAATCTCGAGATTTGGCAAATATCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-2384s1c1
Sequence:CCGGCGGTGGGATTACGAGAGTTTACTCGAGTAAACTCTCGTAATCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-1863s1c1
Sequence:CCGGGCTGAGTTAGAGAATGAAATTCTCGAGAATTTCATTCTCTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-792s1c1
Sequence:CCGGGCCTTAGATGAAGTATTCAAACTCGAGTTTGAATACTTCATCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009784
CACNA2D1 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009784.2-808s21c1
Sequence:CCGGAGCATGCAGCGGTCCATATTCCTCGAGGAATATGGACCGCTGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009784.2-484s21c1
Sequence:CCGGTGACTCAGCTTGCTGATATTTCTCGAGAAATATCAGCAAGCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009784.1-3603s1c1
Sequence:CCGGCCATGACGTAACTAAGCCTTACTCGAGTAAGGCTTAGTTACGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-1336s1c1
Sequence:CCGGCCCAGGAGATATTTGCCAAATCTCGAGATTTGGCAAATATCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-2384s1c1
Sequence:CCGGCGGTGGGATTACGAGAGTTTACTCGAGTAAACTCTCGTAATCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-1863s1c1
Sequence:CCGGGCTGAGTTAGAGAATGAAATTCTCGAGAATTTCATTCTCTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-792s1c1
Sequence:CCGGGCCTTAGATGAAGTATTCAAACTCGAGTTTGAATACTTCATCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009784
CACNA2D1 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009784.2-808s21c1
Sequence:CCGGAGCATGCAGCGGTCCATATTCCTCGAGGAATATGGACCGCTGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009784.2-484s21c1
Sequence:CCGGTGACTCAGCTTGCTGATATTTCTCGAGAAATATCAGCAAGCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009784.1-3603s1c1
Sequence:CCGGCCATGACGTAACTAAGCCTTACTCGAGTAAGGCTTAGTTACGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-1336s1c1
Sequence:CCGGCCCAGGAGATATTTGCCAAATCTCGAGATTTGGCAAATATCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-2384s1c1
Sequence:CCGGCGGTGGGATTACGAGAGTTTACTCGAGTAAACTCTCGTAATCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-1863s1c1
Sequence:CCGGGCTGAGTTAGAGAATGAAATTCTCGAGAATTTCATTCTCTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009784.1-792s1c1
Sequence:CCGGGCCTTAGATGAAGTATTCAAACTCGAGTTTGAATACTTCATCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000722
VALIDATED
CACNA2D1 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000043768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-2080s1c1
Sequence:CCGGCCCATCATGTAACGCGGATTTCTCGAGAAATCCGCGTTACATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-2189s1c1
Sequence:CCGGGCACGATTTGTTGTGACTGATCTCGAGATCAGTCACAACAAATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000722.1-1140s1c1
Sequence:CCGGCCCAGGAGATATTTAACAAATCTCGAGATTTGTTAAATATCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-281s1c1
Sequence:CCGGGCCAGGGATATTGAGAAACTTCTCGAGAAGTTTCTCAATATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000722
VALIDATED
CACNA2D1 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000043768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-2080s1c1
Sequence:CCGGCCCATCATGTAACGCGGATTTCTCGAGAAATCCGCGTTACATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-2189s1c1
Sequence:CCGGGCACGATTTGTTGTGACTGATCTCGAGATCAGTCACAACAAATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000722.1-1140s1c1
Sequence:CCGGCCCAGGAGATATTTAACAAATCTCGAGATTTGTTAAATATCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-281s1c1
Sequence:CCGGGCCAGGGATATTGAGAAACTTCTCGAGAAGTTTCTCAATATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000722
VALIDATED
CACNA2D1 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000043768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-2080s1c1
Sequence:CCGGCCCATCATGTAACGCGGATTTCTCGAGAAATCCGCGTTACATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-2189s1c1
Sequence:CCGGGCACGATTTGTTGTGACTGATCTCGAGATCAGTCACAACAAATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000722.1-1140s1c1
Sequence:CCGGCCCAGGAGATATTTAACAAATCTCGAGATTTGTTAAATATCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000722.1-281s1c1
Sequence:CCGGGCCAGGGATATTGAGAAACTTCTCGAGAAGTTTCTCAATATCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks