EMAIL THIS PAGE TO A FRIEND

CACNA2D2

calcium channel, voltage-dependent, alpha 2/delta subunit 2

109 Gene Product Result for
Synonyms: CACNA2D LUAC11.1
UniProtKB ID: Q9NY47, A7MD15, Q9NY48, Q9UEW0, Q9Y268
Gene ID:
Human(9254) Summary: This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(56808) calcium channel, voltage-dependent, alpha 2/delta subunit 2
Rat(300992) calcium channel, voltage-dependent, alpha 2/delta subunit 2
Zebrafish(541376) calcium channel, voltage-dependent, alpha 2/delta subunit 2
chicken(430150) calcium channel, voltage-dependent, alpha 2/delta subunit 2
dog(100688870) calcium channel, voltage-dependent, alpha 2/delta subunit 2
cow(785909) calcium channel, voltage-dependent, alpha 2/delta subunit 2
domestic cat(101095887) calcium channel, voltage-dependent, alpha 2/delta subunit 2
sheep(101115165) calcium channel, voltage-dependent, alpha 2/delta subunit 2
domestic guinea pig(100734097) calcium channel, voltage-dependent, alpha 2/delta subunit 2
naked mole-rat(101710707) calcium channel, voltage-dependent, alpha 2/delta subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006030 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084041 MISSION® esiRNA esiRNA human CACNA2D2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005505 Rosetta Predictions human pricing
NM_006030 Rosetta Predictions human pricing
NM_175592 Rosetta Predictions rat pricing
NM_020263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088305 predicted 1007
2 SASI_Hs01_00088306 predicted 2703
3 SASI_Hs01_00088307 predicted 2782
4 SASI_Hs01_00088308 predicted 1843
5 SASI_Hs01_00088309 predicted 1684
6 SASI_Hs01_00088310 predicted 1137
7 SASI_Hs02_00304974 predicted 642
8 SASI_Hs01_00088311 predicted 1404
9 SASI_Hs02_00304975 predicted 1219
10 SASI_Hs01_00088312 predicted 954
11 SASI_Hs01_00088304 predicted 2367
12 SASI_Hs01_00088313 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086421 predicted 1013
2 SASI_Hs01_00086422 predicted 2703
3 SASI_Hs01_00086423 predicted 2788
4 SASI_Hs01_00086424 predicted 1847
5 SASI_Hs01_00086425 predicted 1686
6 SASI_Hs01_00086426 predicted 1137
7 SASI_Hs02_00340760 predicted 640
8 SASI_Hs01_00086427 predicted 1413
9 SASI_Hs02_00340761 predicted 1223
10 SASI_Hs01_00086428 predicted 954
11 SASI_Hs01_00086420 predicted 2365
12 SASI_Hs01_00086429 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269490 predicted 1445
2 SASI_Rn01_00083441 predicted 1172
3 SASI_Rn01_00083443 predicted 1945
4 SASI_Rn02_00269491 predicted 926
5 SASI_Rn01_00083444 predicted 706
6 SASI_Rn01_00083446 predicted 2168
7 SASI_Rn01_00083447 predicted 2816
8 SASI_Rn01_00083449 predicted 1162
9 SASI_Rn01_00083450 predicted 1980
10 SASI_Rn02_00269492 predicted 1454
11 SASI_Rn01_00083442 predicted 2896
12 SASI_Rn01_00083445 predicted 702
13 SASI_Rn01_00083448 predicted 3101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110632 predicted 1480
2 SASI_Mm02_00325446 predicted 3725
3 SASI_Mm01_00110633 predicted 1743
4 SASI_Mm01_00110634 predicted 2133
5 SASI_Mm01_00110635 predicted 2685
6 SASI_Mm01_00110636 predicted 902
7 SASI_Mm01_00110637 predicted 1756
8 SASI_Mm01_00110638 predicted 1122
9 SASI_Mm01_00110640 predicted 928
10 SASI_Mm01_00110641 predicted 2462
11 SASI_Mm01_00110639 predicted 2277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020263
CACNA2D2 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-1616s1c1
Sequence:CCGGGCGGGCTAACTGCAATAAGATCTCGAGATCTTATTGCAGTTAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-734s1c1
Sequence:CCGGCCGAGAGATCTACAAGGACAACTCGAGTTGTCCTTGTAGATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-3531s1c1
Sequence:CCGGGCATCCTATAATGCCATCATTCTCGAGAATGATGGCATTATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-3251s1c1
Sequence:CCGGCCGAAAGGAATCCTATGACTACTCGAGTAGTCATAGGATTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-2336s1c1
Sequence:CCGGGCCTATAAGGAGTACCAACTACTCGAGTAGTTGGTACTCCTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020263
CACNA2D2 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-1616s1c1
Sequence:CCGGGCGGGCTAACTGCAATAAGATCTCGAGATCTTATTGCAGTTAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-734s1c1
Sequence:CCGGCCGAGAGATCTACAAGGACAACTCGAGTTGTCCTTGTAGATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-3531s1c1
Sequence:CCGGGCATCCTATAATGCCATCATTCTCGAGAATGATGGCATTATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-3251s1c1
Sequence:CCGGCCGAAAGGAATCCTATGACTACTCGAGTAGTCATAGGATTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-2336s1c1
Sequence:CCGGGCCTATAAGGAGTACCAACTACTCGAGTAGTTGGTACTCCTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020263
CACNA2D2 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-1616s1c1
Sequence:CCGGGCGGGCTAACTGCAATAAGATCTCGAGATCTTATTGCAGTTAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-734s1c1
Sequence:CCGGCCGAGAGATCTACAAGGACAACTCGAGTTGTCCTTGTAGATCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-3531s1c1
Sequence:CCGGGCATCCTATAATGCCATCATTCTCGAGAATGATGGCATTATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-3251s1c1
Sequence:CCGGCCGAAAGGAATCCTATGACTACTCGAGTAGTCATAGGATTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020263.2-2336s1c1
Sequence:CCGGGCCTATAAGGAGTACCAACTACTCGAGTAGTTGGTACTCCTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006030
VALIDATED
CACNA2D2 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006030.1-462s1c1
Sequence:CCGGCCGTGAGATTTACAAGGACAACTCGAGTTGTCCTTGTAAATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1554s1c1
Sequence:CCGGCCGCATCAACACACAGGAATACTCGAGTATTCCTGTGTGTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1764s1c1
Sequence:CCGGCGTGGCTCTGAATGACATCAACTCGAGTTGATGTCATTCAGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006030.1-2802s1c1
Sequence:CCGGCGAGGTTAACAATGAGGACTTCTCGAGAAGTCCTCATTGTTAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1230s1c1
Sequence:CCGGGCGCAACAAGAAGGTGTTCAACTCGAGTTGAACACCTTCTTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006030.2-867s21c1
Sequence:CCGGCGAAGGAGACCCTGGTATATCCTCGAGGATATACCAGGGTCTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006030.2-628s21c1
Sequence:CCGGTCAAGAACAAGGTCAACTATTCTCGAGAATAGTTGACCTTGTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006030.2-4696s21c1
Sequence:CCGGACCATTCATTCTGGTCATTTCCTCGAGGAAATGACCAGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006030.2-1909s21c1
Sequence:CCGGACTACACCTGGGTGCCTATAACTCGAGTTATAGGCACCCAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006030.2-1366s21c1
Sequence:CCGGGTGCCAACAAAGGCTACTATTCTCGAGAATAGTAGCCTTTGTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006030
VALIDATED
CACNA2D2 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006030.1-462s1c1
Sequence:CCGGCCGTGAGATTTACAAGGACAACTCGAGTTGTCCTTGTAAATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1554s1c1
Sequence:CCGGCCGCATCAACACACAGGAATACTCGAGTATTCCTGTGTGTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1764s1c1
Sequence:CCGGCGTGGCTCTGAATGACATCAACTCGAGTTGATGTCATTCAGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006030.1-2802s1c1
Sequence:CCGGCGAGGTTAACAATGAGGACTTCTCGAGAAGTCCTCATTGTTAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1230s1c1
Sequence:CCGGGCGCAACAAGAAGGTGTTCAACTCGAGTTGAACACCTTCTTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006030.2-867s21c1
Sequence:CCGGCGAAGGAGACCCTGGTATATCCTCGAGGATATACCAGGGTCTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006030.2-628s21c1
Sequence:CCGGTCAAGAACAAGGTCAACTATTCTCGAGAATAGTTGACCTTGTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006030.2-4696s21c1
Sequence:CCGGACCATTCATTCTGGTCATTTCCTCGAGGAAATGACCAGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006030.2-1909s21c1
Sequence:CCGGACTACACCTGGGTGCCTATAACTCGAGTTATAGGCACCCAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006030.2-1366s21c1
Sequence:CCGGGTGCCAACAAAGGCTACTATTCTCGAGAATAGTAGCCTTTGTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006030
VALIDATED
CACNA2D2 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006030.1-462s1c1
Sequence:CCGGCCGTGAGATTTACAAGGACAACTCGAGTTGTCCTTGTAAATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1554s1c1
Sequence:CCGGCCGCATCAACACACAGGAATACTCGAGTATTCCTGTGTGTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1764s1c1
Sequence:CCGGCGTGGCTCTGAATGACATCAACTCGAGTTGATGTCATTCAGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006030.1-2802s1c1
Sequence:CCGGCGAGGTTAACAATGAGGACTTCTCGAGAAGTCCTCATTGTTAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006030.1-1230s1c1
Sequence:CCGGGCGCAACAAGAAGGTGTTCAACTCGAGTTGAACACCTTCTTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006030.2-867s21c1
Sequence:CCGGCGAAGGAGACCCTGGTATATCCTCGAGGATATACCAGGGTCTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006030.2-628s21c1
Sequence:CCGGTCAAGAACAAGGTCAACTATTCTCGAGAATAGTTGACCTTGTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006030.2-4696s21c1
Sequence:CCGGACCATTCATTCTGGTCATTTCCTCGAGGAAATGACCAGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006030.2-1909s21c1
Sequence:CCGGACTACACCTGGGTGCCTATAACTCGAGTTATAGGCACCCAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006030.2-1366s21c1
Sequence:CCGGGTGCCAACAAAGGCTACTATTCTCGAGAATAGTAGCCTTTGTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks