EMAIL THIS PAGE TO A FRIEND

CACNA2D3

calcium channel, voltage-dependent, alpha 2/delta subunit 3

269 Gene Product Result for
Synonyms: HSA272268
UniProtKB ID: Q8IZS8, B2RPL6, Q9NY16, Q9NY18
Gene ID:
Human(55799) Summary: This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(12294) calcium channel, voltage-dependent, alpha2/delta subunit 3
Rat(306243) calcium channel, voltage-dependent, alpha2/delta subunit 3
naked mole-rat(101712827) calcium channel, voltage-dependent, alpha 2/delta subunit 3
domestic guinea pig(100724165) calcium channel, voltage-dependent, alpha 2/delta subunit 3
sheep(101105365) calcium channel, voltage-dependent, alpha 2/delta subunit 3
Zebrafish(100535196) calcium channel, voltage-dependent, alpha 2/delta subunit 3
cow(519644) calcium channel, voltage-dependent, alpha 2/delta subunit 3
Horse(100059197) calcium channel, voltage-dependent, alpha 2/delta subunit 3
domestic cat(101094658) calcium channel, voltage-dependent, alpha 2/delta subunit 3
dog(476585) calcium channel, voltage-dependent, alpha 2/delta subunit 3
chicken(415996) calcium channel, voltage-dependent, alpha 2/delta subunit 3
Zebrafish(100148645) calcium channel, voltage dependent, alpha2/delta subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142641 MISSION® esiRNA esiRNA human CACNA2D3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018398 Rosetta Predictions human pricing
NM_175595 Rosetta Predictions rat pricing
NM_009785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144640 predicted 563
2 SASI_Hs01_00144641 predicted 3152
3 SASI_Hs01_00144642 predicted 1610
4 SASI_Hs02_00351889 predicted 582
5 SASI_Hs01_00144643 predicted 843
6 SASI_Hs01_00144644 predicted 746
7 SASI_Hs01_00144645 predicted 1337
8 SASI_Hs01_00144646 predicted 1045
9 SASI_Hs01_00144647 predicted 1933
10 SASI_Hs01_00144648 predicted 2735
11 SASI_Hs01_00144639 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067264 predicted 2632
2 SASI_Rn01_00067266 predicted 659
3 SASI_Rn01_00067267 predicted 1531
4 SASI_Rn01_00067268 predicted 2990
5 SASI_Rn01_00067269 predicted 824
6 SASI_Rn01_00067270 predicted 2538
7 SASI_Rn02_00269494 predicted 696
8 SASI_Rn01_00067272 predicted 2978
9 SASI_Rn01_00067273 predicted 1043
10 SASI_Rn02_00269495 predicted 1559
11 SASI_Rn01_00067265 predicted 217
12 SASI_Rn01_00067271 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138780 predicted 3194
2 SASI_Mm01_00138782 predicted 755
3 SASI_Mm01_00138783 predicted 1805
4 SASI_Mm01_00138785 predicted 2741
5 SASI_Mm01_00138786 predicted 801
6 SASI_Mm02_00317023 predicted 2425
7 SASI_Mm01_00138787 predicted 2667
8 SASI_Mm01_00138788 predicted 1494
9 SASI_Mm01_00138789 predicted 889
10 SASI_Mm02_00317024 predicted 3424
11 SASI_Mm01_00138781 predicted 1895
12 SASI_Mm01_00138784 predicted 3113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018398
CACNA2D3 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018398.2-1844s21c1
Sequence:CCGGTGATGACAAATGACTACTATTCTCGAGAATAGTAGTCATTTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018398.2-3159s21c1
Sequence:CCGGCCTTAAGTGTGAACGTCTAAACTCGAGTTTAGACGTTCACACTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-3015s1c1
Sequence:CCGGCCCATTGAAATCAGGTATAATCTCGAGATTATACCTGATTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-1818s1c1
Sequence:CCGGCGAGGGAATGTAACCATCGAACTCGAGTTCGATGGTTACATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-2783s1c1
Sequence:CCGGGCACTCCGATATGACAGCTAACTCGAGTTAGCTGTCATATCGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-276s1c1
Sequence:CCGGGCACACCTGAAACATGAATTTCTCGAGAAATTCATGTTTCAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-1373s1c1
Sequence:CCGGGCCTGTGTTTAGTAAGCAGAACTCGAGTTCTGCTTACTAAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018398
CACNA2D3 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018398.2-1844s21c1
Sequence:CCGGTGATGACAAATGACTACTATTCTCGAGAATAGTAGTCATTTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018398.2-3159s21c1
Sequence:CCGGCCTTAAGTGTGAACGTCTAAACTCGAGTTTAGACGTTCACACTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-3015s1c1
Sequence:CCGGCCCATTGAAATCAGGTATAATCTCGAGATTATACCTGATTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-1818s1c1
Sequence:CCGGCGAGGGAATGTAACCATCGAACTCGAGTTCGATGGTTACATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-2783s1c1
Sequence:CCGGGCACTCCGATATGACAGCTAACTCGAGTTAGCTGTCATATCGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-276s1c1
Sequence:CCGGGCACACCTGAAACATGAATTTCTCGAGAAATTCATGTTTCAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-1373s1c1
Sequence:CCGGGCCTGTGTTTAGTAAGCAGAACTCGAGTTCTGCTTACTAAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018398
CACNA2D3 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018398.2-1844s21c1
Sequence:CCGGTGATGACAAATGACTACTATTCTCGAGAATAGTAGTCATTTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018398.2-3159s21c1
Sequence:CCGGCCTTAAGTGTGAACGTCTAAACTCGAGTTTAGACGTTCACACTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-3015s1c1
Sequence:CCGGCCCATTGAAATCAGGTATAATCTCGAGATTATACCTGATTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-1818s1c1
Sequence:CCGGCGAGGGAATGTAACCATCGAACTCGAGTTCGATGGTTACATTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-2783s1c1
Sequence:CCGGGCACTCCGATATGACAGCTAACTCGAGTTAGCTGTCATATCGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-276s1c1
Sequence:CCGGGCACACCTGAAACATGAATTTCTCGAGAAATTCATGTTTCAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018398.1-1373s1c1
Sequence:CCGGGCCTGTGTTTAGTAAGCAGAACTCGAGTTCTGCTTACTAAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009785
CACNA2D3 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-2231s1c1
Sequence:CCGGGCCCTCAACAAATCTGAGAATCTCGAGATTCTCAGATTTGTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-1131s1c1
Sequence:CCGGCCTTCAACATACTGAGCGATTCTCGAGAATCGCTCAGTATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-1796s1c1
Sequence:CCGGCGGGATGATGTGTTACGAAATCTCGAGATTTCGTAACACATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-3179s1c1
Sequence:CCGGGCACCCATTGAAATCAGGTATCTCGAGATACCTGATTTCAATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-647s1c1
Sequence:CCGGGCCATTGTCAATGGAGTGTATCTCGAGATACACTCCATTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009785
CACNA2D3 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-2231s1c1
Sequence:CCGGGCCCTCAACAAATCTGAGAATCTCGAGATTCTCAGATTTGTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-1131s1c1
Sequence:CCGGCCTTCAACATACTGAGCGATTCTCGAGAATCGCTCAGTATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-1796s1c1
Sequence:CCGGCGGGATGATGTGTTACGAAATCTCGAGATTTCGTAACACATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-3179s1c1
Sequence:CCGGGCACCCATTGAAATCAGGTATCTCGAGATACCTGATTTCAATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-647s1c1
Sequence:CCGGGCCATTGTCAATGGAGTGTATCTCGAGATACACTCCATTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009785
CACNA2D3 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-2231s1c1
Sequence:CCGGGCCCTCAACAAATCTGAGAATCTCGAGATTCTCAGATTTGTTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-1131s1c1
Sequence:CCGGCCTTCAACATACTGAGCGATTCTCGAGAATCGCTCAGTATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-1796s1c1
Sequence:CCGGCGGGATGATGTGTTACGAAATCTCGAGATTTCGTAACACATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-3179s1c1
Sequence:CCGGGCACCCATTGAAATCAGGTATCTCGAGATACCTGATTTCAATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009785.1-647s1c1
Sequence:CCGGGCCATTGTCAATGGAGTGTATCTCGAGATACACTCCATTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks