EMAIL THIS PAGE TO A FRIEND

CACNA2D4

calcium channel, voltage-dependent, alpha 2/delta subunit 4

82 Gene Product Result for
Synonyms: RCD4
UniProtKB ID: Q7Z3S7, Q7Z3S8, Q86XZ5, Q8IZS9
Gene ID:
Human(93589) Summary: This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(319734) calcium channel, voltage-dependent, alpha 2/delta subunit 4
Rat(312668) calcium channel, voltage-dependent, alpha 2/delta subunit 4
chicken(100858946) calcium channel, voltage-dependent, alpha 2/delta subunit 4
domestic cat(101095834) calcium channel, voltage-dependent, alpha 2/delta subunit 4
cow(784075) calcium channel, voltage-dependent, alpha 2/delta subunit 4
Horse(100630648) calcium channel, voltage-dependent, alpha 2/delta subunit 4
dog(477733) calcium channel, voltage-dependent, alpha 2/delta subunit 4
sheep(101116306) calcium channel, voltage-dependent, alpha 2/delta subunit 4
domestic guinea pig(100716046) calcium channel, voltage-dependent, alpha 2/delta subunit 4
naked mole-rat(101705589) calcium channel, voltage-dependent, alpha 2/delta subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017261 MISSION® esiRNA esiRNA targeting human CACNA2D4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005737 Rosetta Predictions human pricing
NM_001005766 Rosetta Predictions human pricing
NM_172364 Rosetta Predictions human pricing
XM_001056965 Rosetta Predictions rat pricing
XM_232320 Rosetta Predictions rat pricing
NM_001033382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162276 predicted 1209
2 SASI_Hs01_00162277 predicted 824
3 SASI_Hs01_00162278 predicted 2577
4 SASI_Hs01_00162279 predicted 874
5 SASI_Hs01_00162280 predicted 618
6 SASI_Hs01_00162281 predicted 1235
7 SASI_Hs01_00162282 predicted 1903
8 SASI_Hs01_00162283 predicted 897
9 SASI_Hs01_00162284 predicted 1222
10 SASI_Hs01_00162285 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210489 predicted 1213
2 SASI_Hs01_00210490 predicted 824
3 SASI_Hs01_00210491 predicted 2577
4 SASI_Hs01_00210492 predicted 868
5 SASI_Hs01_00210493 predicted 627
6 SASI_Hs01_00210494 predicted 1241
7 SASI_Hs01_00210495 predicted 1911
8 SASI_Hs01_00210496 predicted 900
9 SASI_Hs01_00210497 predicted 1218
10 SASI_Hs01_00210498 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368014 predicted 2462
2 SASI_Hs02_00368015 predicted 2795
3 SASI_Hs01_00188602 predicted 824
4 SASI_Hs01_00188603 predicted 2566
5 SASI_Hs01_00188604 predicted 869
6 SASI_Hs01_00188605 predicted 613
7 SASI_Hs01_00188606 predicted 1230
8 SASI_Hs01_00188607 predicted 1904
9 SASI_Hs01_00188608 predicted 893
10 SASI_Hs01_00188609 predicted 1214
11 SASI_Hs01_00188601 predicted 1205
12 SASI_Hs01_00188610 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284960 predicted 2098
2 SASI_Rn02_00284961 predicted 2965
3 SASI_Rn02_00284962 predicted 1160
4 SASI_Rn02_00284963 predicted 695
5 SASI_Rn02_00284964 predicted 987
6 SASI_Rn02_00284965 predicted 262
7 SASI_Rn02_00284966 predicted 1029
8 SASI_Rn02_00284967 predicted 1040
9 SASI_Rn02_00284968 predicted 1549
10 SASI_Rn02_00284969 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387071 predicted 2101
2 SASI_Rn02_00387072 predicted 2973
3 SASI_Rn02_00387073 predicted 1160
4 SASI_Rn02_00387074 predicted 686
5 SASI_Rn02_00387075 predicted 992
6 SASI_Rn02_00387076 predicted 2099
7 SASI_Rn02_00387077 predicted 1026
8 SASI_Rn02_00387078 predicted 1036
9 SASI_Rn02_00387079 predicted 1554
10 SASI_Rn02_00387080 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099665 predicted 985
2 SASI_Mm01_00099666 predicted 2165
3 SASI_Mm01_00099667 predicted 3032
4 SASI_Mm01_00099668 predicted 2682
5 SASI_Mm01_00099669 predicted 1092
6 SASI_Mm01_00099670 predicted 1050
7 SASI_Mm01_00099671 predicted 1165
8 SASI_Mm01_00099672 predicted 1103
9 SASI_Mm01_00099673 predicted 1311
10 SASI_Mm01_00099674 predicted 982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172364
CACNA2D4 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-1223s1c1
Sequence:CCGGGCGTACAATGACTACGTCCATCTCGAGATGGACGTAGTCATTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-2125s1c1
Sequence:CCGGCCTGACCAATGACTACTTCTTCTCGAGAAGAAGTAGTCATTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-3443s1c1
Sequence:CCGGGCGACAGAAGTCAAATATAATCTCGAGATTATATTTGACTTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-1768s1c1
Sequence:CCGGGCCAGTCTTCAGCAAGAAGAACTCGAGTTCTTCTTGCTGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-712s1c1
Sequence:CCGGCCTGGTGTTCGACTATTACAACTCGAGTTGTAATAGTCGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-2086s21c1
Sequence:CCGGGTGAAGGTTCCGATGGATAAACTCGAGTTTATCCATCGGAACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172364.4-5098s21c1
Sequence:GTACCGGTGCTAGAACAGCTAAGGTTTACTCGAGTAAACCTTAGCTGTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-999s21c1
Sequence:GTACCGGCAGGATCTATCCAGGTATAAACTCGAGTTTATACCTGGATAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-2909s21c1
Sequence:CCGGTCGACAACAACGGGTTCATTCCTCGAGGAATGAACCCGTTGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-956s21c1
Sequence:CCGGCAACGTTGACCTGGCAATATTCTCGAGAATATTGCCAGGTCAACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172364
CACNA2D4 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-1223s1c1
Sequence:CCGGGCGTACAATGACTACGTCCATCTCGAGATGGACGTAGTCATTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-2125s1c1
Sequence:CCGGCCTGACCAATGACTACTTCTTCTCGAGAAGAAGTAGTCATTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-3443s1c1
Sequence:CCGGGCGACAGAAGTCAAATATAATCTCGAGATTATATTTGACTTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-1768s1c1
Sequence:CCGGGCCAGTCTTCAGCAAGAAGAACTCGAGTTCTTCTTGCTGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-712s1c1
Sequence:CCGGCCTGGTGTTCGACTATTACAACTCGAGTTGTAATAGTCGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-2086s21c1
Sequence:CCGGGTGAAGGTTCCGATGGATAAACTCGAGTTTATCCATCGGAACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172364.4-5098s21c1
Sequence:GTACCGGTGCTAGAACAGCTAAGGTTTACTCGAGTAAACCTTAGCTGTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-999s21c1
Sequence:GTACCGGCAGGATCTATCCAGGTATAAACTCGAGTTTATACCTGGATAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-2909s21c1
Sequence:CCGGTCGACAACAACGGGTTCATTCCTCGAGGAATGAACCCGTTGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-956s21c1
Sequence:CCGGCAACGTTGACCTGGCAATATTCTCGAGAATATTGCCAGGTCAACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172364
CACNA2D4 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-1223s1c1
Sequence:CCGGGCGTACAATGACTACGTCCATCTCGAGATGGACGTAGTCATTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-2125s1c1
Sequence:CCGGCCTGACCAATGACTACTTCTTCTCGAGAAGAAGTAGTCATTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-3443s1c1
Sequence:CCGGGCGACAGAAGTCAAATATAATCTCGAGATTATATTTGACTTCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-1768s1c1
Sequence:CCGGGCCAGTCTTCAGCAAGAAGAACTCGAGTTCTTCTTGCTGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172364.2-712s1c1
Sequence:CCGGCCTGGTGTTCGACTATTACAACTCGAGTTGTAATAGTCGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-2086s21c1
Sequence:CCGGGTGAAGGTTCCGATGGATAAACTCGAGTTTATCCATCGGAACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172364.4-5098s21c1
Sequence:GTACCGGTGCTAGAACAGCTAAGGTTTACTCGAGTAAACCTTAGCTGTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-999s21c1
Sequence:GTACCGGCAGGATCTATCCAGGTATAAACTCGAGTTTATACCTGGATAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-2909s21c1
Sequence:CCGGTCGACAACAACGGGTTCATTCCTCGAGGAATGAACCCGTTGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172364.4-956s21c1
Sequence:CCGGCAACGTTGACCTGGCAATATTCTCGAGAATATTGCCAGGTCAACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033382
CACNA2D4 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, alpha 2/delta subunit 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-609s21c1
Sequence:CCGGCTACTACAACTCGGTACTAATCTCGAGATTAGTACCGAGTTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-384s21c1
Sequence:CCGGCAACACGGTGACCAGATATTCCTCGAGGAATATCTGGTCACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-2777s21c1
Sequence:CCGGATCTCGACTGCTTCGTCATAGCTCGAGCTATGACGAAGCAGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033382.2-4014s21c1
Sequence:CCGGTAGGAACGCAATGGATATTAACTCGAGTTAATATCCATTGCGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-1446s21c1
Sequence:CCGGGTGGATCGCCTGCAACAATAACTCGAGTTATTGTTGCAGGCGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033382
CACNA2D4 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, alpha 2/delta subunit 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-609s21c1
Sequence:CCGGCTACTACAACTCGGTACTAATCTCGAGATTAGTACCGAGTTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-384s21c1
Sequence:CCGGCAACACGGTGACCAGATATTCCTCGAGGAATATCTGGTCACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-2777s21c1
Sequence:CCGGATCTCGACTGCTTCGTCATAGCTCGAGCTATGACGAAGCAGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033382.2-4014s21c1
Sequence:CCGGTAGGAACGCAATGGATATTAACTCGAGTTAATATCCATTGCGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-1446s21c1
Sequence:CCGGGTGGATCGCCTGCAACAATAACTCGAGTTATTGTTGCAGGCGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033382
CACNA2D4 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, alpha 2/delta subunit 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-609s21c1
Sequence:CCGGCTACTACAACTCGGTACTAATCTCGAGATTAGTACCGAGTTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-384s21c1
Sequence:CCGGCAACACGGTGACCAGATATTCCTCGAGGAATATCTGGTCACCGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-2777s21c1
Sequence:CCGGATCTCGACTGCTTCGTCATAGCTCGAGCTATGACGAAGCAGTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033382.2-4014s21c1
Sequence:CCGGTAGGAACGCAATGGATATTAACTCGAGTTAATATCCATTGCGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033382.2-1446s21c1
Sequence:CCGGGTGGATCGCCTGCAACAATAACTCGAGTTATTGTTGCAGGCGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks