EMAIL THIS PAGE TO A FRIEND

CACNB1

calcium channel, voltage-dependent, beta 1 subunit

220 Gene Product Result for
Synonyms: CAB1 CACNLB1 CCHLB1
Gene ID:
Human(782) Summary: The protein encoded by this gene belongs to the calcium channel beta subunit family. It plays an important role in the calcium channel by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(12295) calcium channel, voltage-dependent, beta 1 subunit
Rat(50688) calcium channel, voltage-dependent, beta 1 subunit
Zebrafish(436925) calcium channel, voltage-dependent, beta 1 subunit
dog(491030) calcium channel, voltage-dependent, beta 1 subunit
domestic cat(101089057) calcium channel, voltage-dependent, beta 1 subunit
cow(327703) calcium channel, voltage-dependent, beta 1 subunit
naked mole-rat(101714578) calcium channel, voltage-dependent, beta 1 subunit
domestic guinea pig(100721141) calcium channel, voltage-dependent, beta 1 subunit
sheep(101122960) calcium channel, voltage-dependent, beta 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34953 Anti-CACNB1 (AB1) antibody produced in rabbit affinity isolated antibody rat, rabbit, canine, rabbit, bovine, mouse, horse, zebrafish, human, guinea pig
western blot pricing
AV35579 Anti-CACNB1 (AB2) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, bovine, rabbit, human, rat
immunohistochemistry, western blot pricing
SAB1405544 Anti-CACNB1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA023343 Anti-CACNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2100329 Anti-CACNB1 antibody produced in rabbit affinity isolated antibody zebrafish, horse, rabbit, rabbit, human, guinea pig, bovine, mouse, rat
western blot pricing
SAB2104650 Anti-CACNB1 antibody produced in rabbit affinity isolated antibody canine, pig, human, rat, rabbit, rabbit, bovine, horse, zebrafish, guinea pig, mouse
western blot pricing
SAB2106399 Anti-CACNB1 antibody produced in rabbit affinity isolated antibody human, zebrafish, rat, guinea pig, bovine, African clawed frog, rabbit, mouse, rabbit
ELISA, western blot pricing
C5988 Anti-Calcium Channel (β1 subunit) antibody produced in rabbit ~1 mg/mL, fractionated antiserum, buffered aqueous solution human, rat, mouse
western blot pricing
WH0000782M1 Monoclonal Anti-CACNB1 antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5200033 Monoclonal Anti-CACNB1 antibody produced in mouse clone S7-18, 1 mg/mL, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000723 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000723 Rosetta Predictions human pricing
NM_199247 Rosetta Predictions human pricing
NM_199248 Rosetta Predictions human pricing
NM_017346 Rosetta Predictions rat pricing
NM_031173 Rosetta Predictions mouse pricing
NM_145121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029790 predicted 343
2 SASI_Hs01_00029791 predicted 1211
3 SASI_Hs01_00029792 predicted 554
4 SASI_Hs01_00029793 predicted 1180
5 SASI_Hs01_00029794 predicted 253
6 SASI_Hs01_00029795 predicted 1088
7 SASI_Hs01_00029796 predicted 1234
8 SASI_Hs01_00029797 predicted 1260
9 SASI_Hs01_00029798 predicted 1218
10 SASI_Hs01_00029799 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205934 predicted 350
2 SASI_Hs01_00205935 predicted 1341
3 SASI_Hs01_00205936 predicted 549
4 SASI_Hs01_00205937 predicted 1317
5 SASI_Hs01_00205938 predicted 253
6 SASI_Hs01_00205939 predicted 1223
7 SASI_Hs01_00205940 predicted 1371
8 SASI_Hs01_00205941 predicted 1391
9 SASI_Hs01_00205942 predicted 1357
10 SASI_Hs01_00205943 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091667 predicted 348
2 SASI_Hs01_00091668 predicted 1208
3 SASI_Hs01_00091669 predicted 546
4 SASI_Hs01_00091670 predicted 1186
5 SASI_Hs01_00091671 predicted 257
6 SASI_Hs01_00091672 predicted 1087
7 SASI_Hs01_00091673 predicted 1241
8 SASI_Hs01_00091674 predicted 1256
9 SASI_Hs01_00091675 predicted 1218
10 SASI_Hs01_00091676 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101023 predicted 1753
2 SASI_Rn01_00101024 predicted 1150
3 SASI_Rn01_00101025 predicted 1124
4 SASI_Rn01_00101027 predicted 805
5 SASI_Rn02_00261820 predicted 217
6 SASI_Rn01_00101028 predicted 777
7 SASI_Rn02_00261821 predicted 1154
8 SASI_Rn01_00101029 predicted 1212
9 SASI_Rn01_00101030 predicted 848
10 SASI_Rn01_00101031 predicted 1127
11 SASI_Rn01_00101026 predicted 467
12 SASI_Rn01_00101032 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104292 predicted 1431
2 SASI_Mm02_00337005 predicted 1417
3 SASI_Mm01_00104293 predicted 1386
4 SASI_Mm01_00104294 predicted 1297
5 SASI_Mm02_00337006 predicted 1209
6 SASI_Mm01_00104295 predicted 1397
7 SASI_Mm01_00104296 predicted 1415
8 SASI_Mm01_00104298 predicted 1263
9 SASI_Mm02_00337007 predicted 1257
10 SASI_Mm02_00337008 predicted 1432
11 SASI_Mm01_00104289 predicted 468
12 SASI_Mm01_00104290 predicted 600
13 SASI_Mm01_00104291 predicted 584
14 SASI_Mm01_00104297 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038185 predicted 1072
2 SASI_Mm02_00340500 predicted 1059
3 SASI_Mm01_00038186 predicted 1030
4 SASI_Mm01_00038187 predicted 936
5 SASI_Mm02_00340501 predicted 846
6 SASI_Mm01_00038188 predicted 1047
7 SASI_Mm01_00038189 predicted 1061
8 SASI_Mm01_00038191 predicted 910
9 SASI_Mm02_00340502 predicted 899
10 SASI_Mm02_00340503 predicted 1082
11 SASI_Mm01_00038182 predicted 270
12 SASI_Mm01_00038183 predicted 387
13 SASI_Mm01_00038184 predicted 372
14 SASI_Mm01_00038190 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031173
CACNB1 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 1 subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-1388s21c1
Sequence:CCGGGTACTGCAGAGGCTCATCAAACTCGAGTTTGATGAGCCTCTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-1137s21c1
Sequence:CCGGCCCGGGTAACAGCTGACATTTCTCGAGAAATGTCAGCTGTTACCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-519s21c1
Sequence:CCGGGGACAAATGTTGGCTACAATCCTCGAGGATTGTAGCCAACATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-829s1c1
Sequence:CCGGCCAGTGGTAATGAAATGACTACTCGAGTAGTCATTTCATTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1191s1c1
Sequence:CCGGCCCAGCAAACACATCATCATTCTCGAGAATGATGATGTGTTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-343s1c1
Sequence:CCGGCCTCGGATACAACATCCAACACTCGAGTGTTGGATGTTGTATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1691s1c1
Sequence:CCGGGCTCAGGAGAAATCTCAGCTTCTCGAGAAGCTGAGATTTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1416s1c1
Sequence:CCGGCGAGGGAAGTCTCAATCCAAACTCGAGTTTGGATTGAGACTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031173
CACNB1 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 1 subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-1388s21c1
Sequence:CCGGGTACTGCAGAGGCTCATCAAACTCGAGTTTGATGAGCCTCTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-1137s21c1
Sequence:CCGGCCCGGGTAACAGCTGACATTTCTCGAGAAATGTCAGCTGTTACCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-519s21c1
Sequence:CCGGGGACAAATGTTGGCTACAATCCTCGAGGATTGTAGCCAACATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-829s1c1
Sequence:CCGGCCAGTGGTAATGAAATGACTACTCGAGTAGTCATTTCATTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1191s1c1
Sequence:CCGGCCCAGCAAACACATCATCATTCTCGAGAATGATGATGTGTTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-343s1c1
Sequence:CCGGCCTCGGATACAACATCCAACACTCGAGTGTTGGATGTTGTATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1691s1c1
Sequence:CCGGGCTCAGGAGAAATCTCAGCTTCTCGAGAAGCTGAGATTTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1416s1c1
Sequence:CCGGCGAGGGAAGTCTCAATCCAAACTCGAGTTTGGATTGAGACTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031173
CACNB1 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 1 subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-1388s21c1
Sequence:CCGGGTACTGCAGAGGCTCATCAAACTCGAGTTTGATGAGCCTCTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-1137s21c1
Sequence:CCGGCCCGGGTAACAGCTGACATTTCTCGAGAAATGTCAGCTGTTACCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031173.3-519s21c1
Sequence:CCGGGGACAAATGTTGGCTACAATCCTCGAGGATTGTAGCCAACATTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-829s1c1
Sequence:CCGGCCAGTGGTAATGAAATGACTACTCGAGTAGTCATTTCATTACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1191s1c1
Sequence:CCGGCCCAGCAAACACATCATCATTCTCGAGAATGATGATGTGTTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-343s1c1
Sequence:CCGGCCTCGGATACAACATCCAACACTCGAGTGTTGGATGTTGTATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1691s1c1
Sequence:CCGGGCTCAGGAGAAATCTCAGCTTCTCGAGAAGCTGAGATTTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031173.1-1416s1c1
Sequence:CCGGCGAGGGAAGTCTCAATCCAAACTCGAGTTTGGATTGAGACTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000723
CACNB1 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 1 subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-251s21c1
Sequence:CCGGAGAGGAAAGGGCGATTCAAACCTCGAGGTTTGAATCGCCCTTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-893s21c1
Sequence:CCGGTGATGCAGAAAGCTTTATTTGCTCGAGCAAATAAAGCTTTCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-700s21c1
Sequence:CCGGTCCAGCAAATCAGGCGATAACCTCGAGGTTATCGCCTGATTTGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-443s21c1
Sequence:CCGGAGACCAAGCCAGTGGCATTTGCTCGAGCAAATGCCACTGGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000723.3-3456s1c1
Sequence:CCGGGCCCTGAGTCATTGACTCAAACTCGAGTTTGAGTCAATGACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-1296s1c1
Sequence:CCGGCCCTGAAATGTTTGACATCATCTCGAGATGATGTCAAACATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-1228s1c1
Sequence:CCGGCGAGGAAAGTCTCAGTCCAAACTCGAGTTTGGACTGAGACTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-349s1c1
Sequence:CCGGCGTCCATCAGACTCTGATGTACTCGAGTACATCAGAGTCTGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000723
CACNB1 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 1 subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-251s21c1
Sequence:CCGGAGAGGAAAGGGCGATTCAAACCTCGAGGTTTGAATCGCCCTTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-893s21c1
Sequence:CCGGTGATGCAGAAAGCTTTATTTGCTCGAGCAAATAAAGCTTTCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-700s21c1
Sequence:CCGGTCCAGCAAATCAGGCGATAACCTCGAGGTTATCGCCTGATTTGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-443s21c1
Sequence:CCGGAGACCAAGCCAGTGGCATTTGCTCGAGCAAATGCCACTGGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000723.3-3456s1c1
Sequence:CCGGGCCCTGAGTCATTGACTCAAACTCGAGTTTGAGTCAATGACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-1296s1c1
Sequence:CCGGCCCTGAAATGTTTGACATCATCTCGAGATGATGTCAAACATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-1228s1c1
Sequence:CCGGCGAGGAAAGTCTCAGTCCAAACTCGAGTTTGGACTGAGACTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-349s1c1
Sequence:CCGGCGTCCATCAGACTCTGATGTACTCGAGTACATCAGAGTCTGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000723
CACNB1 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 1 subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-251s21c1
Sequence:CCGGAGAGGAAAGGGCGATTCAAACCTCGAGGTTTGAATCGCCCTTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-893s21c1
Sequence:CCGGTGATGCAGAAAGCTTTATTTGCTCGAGCAAATAAAGCTTTCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-700s21c1
Sequence:CCGGTCCAGCAAATCAGGCGATAACCTCGAGGTTATCGCCTGATTTGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000723.3-443s21c1
Sequence:CCGGAGACCAAGCCAGTGGCATTTGCTCGAGCAAATGCCACTGGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000723.3-3456s1c1
Sequence:CCGGGCCCTGAGTCATTGACTCAAACTCGAGTTTGAGTCAATGACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-1296s1c1
Sequence:CCGGCCCTGAAATGTTTGACATCATCTCGAGATGATGTCAAACATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-1228s1c1
Sequence:CCGGCGAGGAAAGTCTCAGTCCAAACTCGAGTTTGGACTGAGACTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000723.3-349s1c1
Sequence:CCGGCGTCCATCAGACTCTGATGTACTCGAGTACATCAGAGTCTGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks