EMAIL THIS PAGE TO A FRIEND

CACNB2

calcium channel, voltage-dependent, beta 2 subunit

280 Gene Product Result for
Synonyms: CACNLB2 CAVB2 MYSB
Gene ID:
Human(783) Summary: This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
Mouse(12296) calcium channel, voltage-dependent, beta 2 subunit
Rat(116600) calcium channel, voltage-dependent, beta 2 subunit
sheep(101112498) calcium channel, voltage-dependent, beta 2 subunit
Domestic Rabbit(100009277) calcium channel, voltage-dependent, beta 2 subunit
domestic guinea pig(100192393) calcium channel, voltage-dependent, beta 2 subunit
naked mole-rat(101713647) calcium channel, voltage-dependent, beta 2 subunit
chicken(428420) calcium channel, voltage-dependent, beta 2 subunit
domestic cat(101093028) calcium channel, voltage-dependent, beta 2 subunit
Horse(100055971) calcium channel, voltage-dependent, beta 2 subunit
cow(327667) calcium channel, voltage-dependent, beta 2 subunit
dog(487113) calcium channel, voltage-dependent, beta 2 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100330 Anti-CACNB2 (ab1) antibody produced in rabbit affinity isolated antibody rabbit, human, rat, rabbit, bovine, guinea pig, mouse
western blot pricing
AV34955 Anti-CACNB2 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, human, guinea pig, horse, rabbit, rat, rabbit, mouse
western blot pricing
SAB2100331 Anti-CACNB2 (ab2) antibody produced in rabbit affinity isolated antibody rat, guinea pig, rabbit, rabbit, horse, bovine, human, canine, mouse
western blot pricing
AV36761 Anti-CACNB2 (AB2) antibody produced in rabbit affinity isolated antibody canine, bovine, rabbit, rabbit, guinea pig, human, rat, horse, mouse
western blot pricing
AV35590 Anti-CACNB2 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, rat, rabbit, human, horse, bovine, guinea pig, rabbit, mouse
western blot pricing
AV35598 Anti-CACNB2 (AB3) antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, bovine, canine, rabbit, human, rabbit, horse, rat
western blot pricing
SAB2502014 Anti-CACNB2 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, bovine, human, canine
ELISA, western blot pricing
SAB1412017 ANTI-CACNB2 antibody produced in mouse clone 5B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412149 ANTI-CACNB2 antibody produced in mouse clone 5C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412179 ANTI-CACNB2 antibody produced in mouse clone 6H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA035325 Anti-CACNB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104300 Anti-CACNB2 antibody produced in rabbit affinity isolated antibody bovine, rabbit, mouse, horse, canine, human, guinea pig, rat, rabbit
western blot pricing
SAB2105083 Anti-CACNB2 antibody produced in rabbit affinity isolated antibody rat, mouse, human, guinea pig, horse, rabbit
western blot pricing
HPA035326 Anti-CACNB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
C5738 Anti-Calcium Channel (β2 subunit) (Voltage Gated Ca2+ Channel) antibody produced in rabbit ~1 mg/mL, fractionated antiserum, buffered aqueous solution mouse, rat, human
western blot pricing
WH0000783M1 Monoclonal Anti-CACNB2 antibody produced in mouse clone 6C1, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1403628 Monoclonal Anti-CACNB2 antibody produced in mouse clone 6C4, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB5200044 Monoclonal Anti-CACNB2 antibody produced in mouse clone S8B-1, 1 mg/mL, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000724 Rosetta Predictions human pricing
NM_201570 Rosetta Predictions human pricing
NM_201571 Rosetta Predictions human pricing
NM_201572 Rosetta Predictions human pricing
NM_201590 Rosetta Predictions human pricing
NM_201593 Rosetta Predictions human pricing
NM_201596 Rosetta Predictions human pricing
NM_201597 Rosetta Predictions human pricing
NM_053851 Rosetta Predictions rat pricing
NM_023116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092397 predicted 2771
2 SASI_Hs01_00092398 predicted 2146
3 SASI_Hs02_00303144 predicted 1880
4 SASI_Hs01_00092401 predicted 1455
5 SASI_Hs02_00303145 predicted 1510
6 SASI_Hs01_00092402 predicted 1689
7 SASI_Hs02_00303146 predicted 1464
8 SASI_Hs02_00303147 predicted 2106
9 SASI_Hs02_00303148 predicted 1759
10 SASI_Hs02_00303149 predicted 2006
11 SASI_Hs01_00092399 predicted 2576
12 SASI_Hs01_00092400 predicted 1601
13 SASI_Hs01_00092403 predicted 1813
14 SASI_Hs01_00092404 predicted 1378
15 SASI_Hs01_00092405 predicted 1767
16 SASI_Hs01_00092406 predicted 2596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214790 predicted 2624
2 SASI_Hs01_00214791 predicted 1993
3 SASI_Hs02_00373061 predicted 1727
4 SASI_Hs01_00214794 predicted 1305
5 SASI_Hs02_00373062 predicted 1364
6 SASI_Hs01_00214795 predicted 1548
7 SASI_Hs02_00373063 predicted 1312
8 SASI_Hs02_00373064 predicted 1958
9 SASI_Hs02_00373065 predicted 1607
10 SASI_Hs02_00373066 predicted 1856
11 SASI_Hs01_00214792 predicted 2095
12 SASI_Hs01_00214793 predicted 1119
13 SASI_Hs01_00214796 predicted 1333
14 SASI_Hs01_00214797 predicted 900
15 SASI_Hs01_00214798 predicted 1287
16 SASI_Hs01_00214799 predicted 2116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074033 predicted 2529
2 SASI_Hs01_00074034 predicted 1912
3 SASI_Hs02_00373067 predicted 1644
4 SASI_Hs01_00074037 predicted 1218
5 SASI_Hs02_00373068 predicted 1270
6 SASI_Hs01_00074038 predicted 1460
7 SASI_Hs02_00373069 predicted 1228
8 SASI_Hs02_00373070 predicted 1868
9 SASI_Hs02_00373071 predicted 1517
10 SASI_Hs02_00373072 predicted 1765
11 SASI_Hs01_00074035 predicted 2154
12 SASI_Hs01_00074036 predicted 1176
13 SASI_Hs01_00074039 predicted 1387
14 SASI_Hs01_00074040 predicted 951
15 SASI_Hs01_00074041 predicted 1343
16 SASI_Hs01_00074042 predicted 2184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023886 predicted 2465
2 SASI_Hs01_00023887 predicted 1835
3 SASI_Hs02_00373073 predicted 1572
4 SASI_Hs01_00023890 predicted 1146
5 SASI_Hs02_00373074 predicted 1204
6 SASI_Hs01_00023891 predicted 1389
7 SASI_Hs02_00373075 predicted 1153
8 SASI_Hs02_00373076 predicted 1795
9 SASI_Hs02_00373077 predicted 1449
10 SASI_Hs02_00373078 predicted 1692
11 SASI_Hs01_00023888 predicted 2089
12 SASI_Hs01_00023889 predicted 1104
13 SASI_Hs01_00023892 predicted 1319
14 SASI_Hs01_00023893 predicted 886
15 SASI_Hs01_00023894 predicted 1266
16 SASI_Hs01_00023895 predicted 2112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076339 predicted 2394
2 SASI_Hs01_00076340 predicted 1771
3 SASI_Hs02_00373087 predicted 1504
4 SASI_Hs01_00076343 predicted 1084
5 SASI_Hs02_00373088 predicted 1143
6 SASI_Hs01_00076344 predicted 1318
7 SASI_Hs02_00373089 predicted 1096
8 SASI_Hs02_00373090 predicted 1735
9 SASI_Hs02_00373091 predicted 1391
10 SASI_Hs02_00373092 predicted 1629
11 SASI_Hs01_00076341 predicted 2235
12 SASI_Hs01_00076342 predicted 1252
13 SASI_Hs01_00076345 predicted 1467
14 SASI_Hs01_00076346 predicted 1026
15 SASI_Hs01_00076347 predicted 1419
16 SASI_Hs01_00076348 predicted 2250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092287 predicted 2262
2 SASI_Hs01_00092288 predicted 1639
3 SASI_Hs02_00373095 predicted 1375
4 SASI_Hs01_00092291 predicted 952
5 SASI_Hs02_00373096 predicted 1003
6 SASI_Hs01_00092292 predicted 1183
7 SASI_Hs02_00373097 predicted 958
8 SASI_Hs02_00373098 predicted 1594
9 SASI_Hs02_00373099 predicted 1257
10 SASI_Hs02_00373100 predicted 1500
11 SASI_Hs01_00092289 predicted 2179
12 SASI_Hs01_00092290 predicted 1204
13 SASI_Hs01_00092293 predicted 1412
14 SASI_Hs01_00092294 predicted 972
15 SASI_Hs01_00092295 predicted 1367
16 SASI_Hs01_00092296 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200537 predicted 2374
2 SASI_Hs01_00200538 predicted 1749
3 SASI_Hs02_00373103 predicted 1483
4 SASI_Hs01_00200541 predicted 1068
5 SASI_Hs02_00373104 predicted 1122
6 SASI_Hs01_00200542 predicted 1303
7 SASI_Hs02_00373105 predicted 1072
8 SASI_Hs02_00373106 predicted 1707
9 SASI_Hs02_00373107 predicted 1364
10 SASI_Hs02_00373108 predicted 1613
11 SASI_Hs01_00200539 predicted 2305
12 SASI_Hs01_00200540 predicted 1326
13 SASI_Hs01_00200543 predicted 1536
14 SASI_Hs01_00200544 predicted 1103
15 SASI_Hs01_00200545 predicted 1481
16 SASI_Hs01_00200546 predicted 2326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068285 predicted 2302
2 SASI_Hs01_00068286 predicted 1678
3 SASI_Hs02_00373109 predicted 1413
4 SASI_Hs01_00068289 predicted 993
5 SASI_Hs02_00373110 predicted 1045
6 SASI_Hs01_00068290 predicted 1233
7 SASI_Hs02_00373111 predicted 999
8 SASI_Hs02_00373112 predicted 1644
9 SASI_Hs02_00373113 predicted 1298
10 SASI_Hs02_00373114 predicted 1542
11 SASI_Hs01_00068287 predicted 2234
12 SASI_Hs01_00068288 predicted 1255
13 SASI_Hs01_00068291 predicted 1465
14 SASI_Hs01_00068292 predicted 1026
15 SASI_Hs01_00068293 predicted 1419
16 SASI_Hs01_00068294 predicted 2255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037528 predicted 811
2 SASI_Rn01_00037529 predicted 1211
3 SASI_Rn01_00037531 predicted 780
4 SASI_Rn01_00037532 predicted 823
5 SASI_Rn01_00037533 predicted 835
6 SASI_Rn01_00037534 predicted 680
7 SASI_Rn02_00266706 predicted 1517
8 SASI_Rn01_00037535 predicted 1378
9 SASI_Rn01_00037536 predicted 1687
10 SASI_Rn01_00037537 predicted 1144
11 SASI_Rn01_00037530 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021349 predicted 1997
2 SASI_Mm01_00021350 predicted 1442
3 SASI_Mm01_00021351 predicted 1138
4 SASI_Mm01_00021352 predicted 603
5 SASI_Mm01_00021353 predicted 708
6 SASI_Mm01_00021354 predicted 1605
7 SASI_Mm01_00021355 predicted 759
8 SASI_Mm01_00021356 predicted 1067
9 SASI_Mm01_00021357 predicted 1565
10 SASI_Mm01_00021358 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023116
CACNB2 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 2 subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-724s1c1
Sequence:CCGGCCAGTAAATCAGGAGGGAATTCTCGAGAATTCCCTCCTGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1436s1c1
Sequence:CCGGGCAGGAATCATTTGATGTGATCTCGAGATCACATCAAATGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1839s1c1
Sequence:CCGGCCAAAGGAAGATTATTCACATCTCGAGATGTGAATAATCTTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-2081s1c1
Sequence:CCGGCGAGTGGAACAGGGATGTATACTCGAGTATACATCCCTGTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1675s1c1
Sequence:CCGGCCCAAGCTGAAGAAGAACCTTCTCGAGAAGGTTCTTCTTCAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023116
CACNB2 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 2 subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-724s1c1
Sequence:CCGGCCAGTAAATCAGGAGGGAATTCTCGAGAATTCCCTCCTGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1436s1c1
Sequence:CCGGGCAGGAATCATTTGATGTGATCTCGAGATCACATCAAATGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1839s1c1
Sequence:CCGGCCAAAGGAAGATTATTCACATCTCGAGATGTGAATAATCTTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-2081s1c1
Sequence:CCGGCGAGTGGAACAGGGATGTATACTCGAGTATACATCCCTGTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1675s1c1
Sequence:CCGGCCCAAGCTGAAGAAGAACCTTCTCGAGAAGGTTCTTCTTCAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023116
CACNB2 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 2 subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-724s1c1
Sequence:CCGGCCAGTAAATCAGGAGGGAATTCTCGAGAATTCCCTCCTGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1436s1c1
Sequence:CCGGGCAGGAATCATTTGATGTGATCTCGAGATCACATCAAATGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1839s1c1
Sequence:CCGGCCAAAGGAAGATTATTCACATCTCGAGATGTGAATAATCTTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-2081s1c1
Sequence:CCGGCGAGTGGAACAGGGATGTATACTCGAGTATACATCCCTGTTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023116.1-1675s1c1
Sequence:CCGGCCCAAGCTGAAGAAGAACCTTCTCGAGAAGGTTCTTCTTCAGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000724
CACNB2 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 2 subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1766s1c1
Sequence:CCGGGCCGTACATTAGCCACTTCAACTCGAGTTGAAGTGGCTAATGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1567s1c1
Sequence:CCGGCGAGGGAAATCTCAAGCTAAACTCGAGTTTAGCTTGAGATTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1353s1c1
Sequence:CCGGCGCAATAATAGAAAGATCCAACTCGAGTTGGATCTTTCTATTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-926s1c1
Sequence:CCGGCCAGTAAATCAGGAGGAAATTCTCGAGAATTTCCTCCTGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1328s1c1
Sequence:CCGGCGGTATTAAACAATCCCAGTACTCGAGTACTGGGATTGTTTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-2318s21c1
Sequence:CCGGAGCAGCGCAGCCGTCATAAATCTCGAGATTTATGACGGCTGCGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-1379s21c1
Sequence:CCGGACAGATTTGAAGGGCGGATATCTCGAGATATCCGCCCTTCAAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-924s21c1
Sequence:CCGGGTGGATAGGGCGATTGGTAAACTCGAGTTTACCAATCGCCCTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000724
CACNB2 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 2 subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1766s1c1
Sequence:CCGGGCCGTACATTAGCCACTTCAACTCGAGTTGAAGTGGCTAATGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1567s1c1
Sequence:CCGGCGAGGGAAATCTCAAGCTAAACTCGAGTTTAGCTTGAGATTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1353s1c1
Sequence:CCGGCGCAATAATAGAAAGATCCAACTCGAGTTGGATCTTTCTATTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-926s1c1
Sequence:CCGGCCAGTAAATCAGGAGGAAATTCTCGAGAATTTCCTCCTGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1328s1c1
Sequence:CCGGCGGTATTAAACAATCCCAGTACTCGAGTACTGGGATTGTTTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-2318s21c1
Sequence:CCGGAGCAGCGCAGCCGTCATAAATCTCGAGATTTATGACGGCTGCGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-1379s21c1
Sequence:CCGGACAGATTTGAAGGGCGGATATCTCGAGATATCCGCCCTTCAAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-924s21c1
Sequence:CCGGGTGGATAGGGCGATTGGTAAACTCGAGTTTACCAATCGCCCTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000724
CACNB2 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 2 subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1766s1c1
Sequence:CCGGGCCGTACATTAGCCACTTCAACTCGAGTTGAAGTGGCTAATGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1567s1c1
Sequence:CCGGCGAGGGAAATCTCAAGCTAAACTCGAGTTTAGCTTGAGATTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1353s1c1
Sequence:CCGGCGCAATAATAGAAAGATCCAACTCGAGTTGGATCTTTCTATTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-926s1c1
Sequence:CCGGCCAGTAAATCAGGAGGAAATTCTCGAGAATTTCCTCCTGATTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000724.2-1328s1c1
Sequence:CCGGCGGTATTAAACAATCCCAGTACTCGAGTACTGGGATTGTTTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-2318s21c1
Sequence:CCGGAGCAGCGCAGCCGTCATAAATCTCGAGATTTATGACGGCTGCGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-1379s21c1
Sequence:CCGGACAGATTTGAAGGGCGGATATCTCGAGATATCCGCCCTTCAAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000724.3-924s21c1
Sequence:CCGGGTGGATAGGGCGATTGGTAAACTCGAGTTTACCAATCGCCCTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks