EMAIL THIS PAGE TO A FRIEND

CACNB3

calcium channel, voltage-dependent, beta 3 subunit

172 Gene Product Result for
Synonyms: CAB3 CACNLB3
Gene ID:
Human(784) Summary: This gene encodes a regulatory beta subunit of the voltage-dependent calcium channel. Beta subunits are composed of five domains, which contribute to the regulation of surface expression and gating of calcium channels and may also play a role in the regulation of transcription factors and calcium transport. [provided by RefSeq, Oct 2011]
Mouse(12297) calcium channel, voltage-dependent, beta 3 subunit
Rat(25297) calcium channel, voltage-dependent, beta 3 subunit
cow(282160) calcium channel, voltage-dependent, beta 3 subunit
Horse(100051367) calcium channel, voltage-dependent, beta 3 subunit
domestic cat(101091635) calcium channel, voltage-dependent, beta 3 subunit
dog(486563) calcium channel, voltage-dependent, beta 3 subunit
naked mole-rat(101696342) calcium channel, voltage-dependent, beta 3 subunit
domestic guinea pig(100730569) calcium channel, voltage-dependent, beta 3 subunit
sheep(101104978) calcium channel, voltage-dependent, beta 3 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
F131 FPL 64176 ≥98% (HPLC), powder rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000725 Rosetta Predictions human pricing
NM_012828 Rosetta Predictions rat pricing
NM_001044741 Rosetta Predictions mouse pricing
NM_007581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303150 predicted 1574
2 SASI_Hs01_00214684 predicted 1857
3 SASI_Hs01_00214685 predicted 444
4 SASI_Hs01_00214687 predicted 1149
5 SASI_Hs01_00214688 predicted 980
6 SASI_Hs01_00214689 predicted 1154
7 SASI_Hs01_00214690 predicted 401
8 SASI_Hs01_00214691 predicted 1127
9 SASI_Hs01_00214692 predicted 473
10 SASI_Hs02_00303151 predicted 1254
11 SASI_Hs01_00214683 predicted 961
12 SASI_Hs01_00214686 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114888 predicted 1029
2 SASI_Rn01_00114889 predicted 410
3 SASI_Rn01_00114890 predicted 1603
4 SASI_Rn01_00114891 predicted 1047
5 SASI_Rn01_00114892 predicted 1145
6 SASI_Rn01_00114893 predicted 1134
7 SASI_Rn02_00260280 predicted 1033
8 SASI_Rn01_00114894 predicted 836
9 SASI_Rn01_00114895 predicted 293
10 SASI_Rn01_00114896 predicted 959
11 SASI_Rn01_00114897 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291404 predicted 1797
2 SASI_Mm02_00291405 predicted 1006
3 SASI_Mm02_00291406 predicted 1772
4 SASI_Mm02_00291407 predicted 1304
5 SASI_Mm02_00291408 predicted 1201
6 SASI_Mm02_00291409 predicted 504
7 SASI_Mm02_00291410 predicted 813
8 SASI_Mm02_00291411 predicted 416
9 SASI_Mm02_00291412 predicted 1184
10 SASI_Mm02_00291413 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036350 predicted 1157
2 SASI_Mm01_00036354 predicted 1919
3 SASI_Mm01_00036351 predicted 1450
4 SASI_Mm01_00036352 predicted 1351
5 SASI_Mm01_00036355 predicted 969
6 SASI_Mm01_00036358 predicted 1333
7 SASI_Mm02_00311972 predicted 2131
8 SASI_Mm02_00311973 predicted 678
9 SASI_Mm02_00311974 predicted 1464
10 SASI_Mm02_00311975 predicted 1272
11 SASI_Mm01_00036353 predicted 311
12 SASI_Mm01_00036356 predicted 228
13 SASI_Mm01_00036357 predicted 1602
14 SASI_Mm01_00036359 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000725
CACNB3 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 3 subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000725.2-1094s21c1
Sequence:CCGGAGGTACTCCAGCGTCTCATTCCTCGAGGAATGAGACGCTGGAGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000725.2-875s21c1
Sequence:CCGGAGCGATCTGTGCTCAACAATCCTCGAGGATTGTTGAGCACAGATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1189s1c1
Sequence:CCGGCCGGAGTCATTTGATGTGATTCTCGAGAATCACATCAAATGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1060s1c1
Sequence:CCGGCCCATCATCGTCTTTGTCAAACTCGAGTTTGACAAAGACGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1146s1c1
Sequence:CCGGGACCGTACAGATGATGGCATACTCGAGTATGCCATCATCTGTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-954s1c1
Sequence:CCGGGAGTGAGATCGAGCGCATATTCTCGAGAATATGCGCTCGATCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-450s1c1
Sequence:CCGGTGGAGTCAACTTTGAGGCCAACTCGAGTTGGCCTCAAAGTTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000725
CACNB3 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 3 subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000725.2-1094s21c1
Sequence:CCGGAGGTACTCCAGCGTCTCATTCCTCGAGGAATGAGACGCTGGAGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000725.2-875s21c1
Sequence:CCGGAGCGATCTGTGCTCAACAATCCTCGAGGATTGTTGAGCACAGATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1189s1c1
Sequence:CCGGCCGGAGTCATTTGATGTGATTCTCGAGAATCACATCAAATGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1060s1c1
Sequence:CCGGCCCATCATCGTCTTTGTCAAACTCGAGTTTGACAAAGACGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1146s1c1
Sequence:CCGGGACCGTACAGATGATGGCATACTCGAGTATGCCATCATCTGTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-954s1c1
Sequence:CCGGGAGTGAGATCGAGCGCATATTCTCGAGAATATGCGCTCGATCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-450s1c1
Sequence:CCGGTGGAGTCAACTTTGAGGCCAACTCGAGTTGGCCTCAAAGTTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000725
CACNB3 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 3 subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000725.2-1094s21c1
Sequence:CCGGAGGTACTCCAGCGTCTCATTCCTCGAGGAATGAGACGCTGGAGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000725.2-875s21c1
Sequence:CCGGAGCGATCTGTGCTCAACAATCCTCGAGGATTGTTGAGCACAGATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1189s1c1
Sequence:CCGGCCGGAGTCATTTGATGTGATTCTCGAGAATCACATCAAATGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1060s1c1
Sequence:CCGGCCCATCATCGTCTTTGTCAAACTCGAGTTTGACAAAGACGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-1146s1c1
Sequence:CCGGGACCGTACAGATGATGGCATACTCGAGTATGCCATCATCTGTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-954s1c1
Sequence:CCGGGAGTGAGATCGAGCGCATATTCTCGAGAATATGCGCTCGATCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000725.2-450s1c1
Sequence:CCGGTGGAGTCAACTTTGAGGCCAACTCGAGTTGGCCTCAAAGTTGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007581
VALIDATED
CACNB3 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 3 subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-586s21c1
Sequence:CCGGGCATTTGCTGTGAGGACCAATCTCGAGATTGGTCCTCACAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1147s21c1
Sequence:CCGGGCTGAAGTGCAGAGTGAGATTCTCGAGAATCTCACTCTGCACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1450s21c1
Sequence:CCGGCTGGCTGAATACTTAGAGGTTCTCGAGAACCTCTAAGTATTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1000s21c1
Sequence:CCGGGCGCTCTTCGACTTCCTTAAACTCGAGTTTAAGGAAGTCGAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007581.2-2557s21c1
Sequence:CCGGCCCTTGCTCTTCTCATTCTTTCTCGAGAAAGAATGAGAAGAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-2208s1c1
Sequence:CCGGCCCTTGCTCTTCTCATTCTTTCTCGAGAAAGAATGAGAAGAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-237s1c1
Sequence:CCGGGCATTTGCTGTGAGGACCAATCTCGAGATTGGTCCTCACAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-798s1c1
Sequence:CCGGGCTGAAGTGCAGAGTGAGATTCTCGAGAATCTCACTCTGCACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-1101s1c1
Sequence:CCGGCTGGCTGAATACTTAGAGGTTCTCGAGAACCTCTAAGTATTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-651s1c1
Sequence:CCGGGCGCTCTTCGACTTCCTTAAACTCGAGTTTAAGGAAGTCGAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007581
VALIDATED
CACNB3 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 3 subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-586s21c1
Sequence:CCGGGCATTTGCTGTGAGGACCAATCTCGAGATTGGTCCTCACAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1147s21c1
Sequence:CCGGGCTGAAGTGCAGAGTGAGATTCTCGAGAATCTCACTCTGCACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1450s21c1
Sequence:CCGGCTGGCTGAATACTTAGAGGTTCTCGAGAACCTCTAAGTATTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1000s21c1
Sequence:CCGGGCGCTCTTCGACTTCCTTAAACTCGAGTTTAAGGAAGTCGAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007581.2-2557s21c1
Sequence:CCGGCCCTTGCTCTTCTCATTCTTTCTCGAGAAAGAATGAGAAGAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-2208s1c1
Sequence:CCGGCCCTTGCTCTTCTCATTCTTTCTCGAGAAAGAATGAGAAGAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-237s1c1
Sequence:CCGGGCATTTGCTGTGAGGACCAATCTCGAGATTGGTCCTCACAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-798s1c1
Sequence:CCGGGCTGAAGTGCAGAGTGAGATTCTCGAGAATCTCACTCTGCACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-1101s1c1
Sequence:CCGGCTGGCTGAATACTTAGAGGTTCTCGAGAACCTCTAAGTATTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-651s1c1
Sequence:CCGGGCGCTCTTCGACTTCCTTAAACTCGAGTTTAAGGAAGTCGAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007581
VALIDATED
CACNB3 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 3 subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-586s21c1
Sequence:CCGGGCATTTGCTGTGAGGACCAATCTCGAGATTGGTCCTCACAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1147s21c1
Sequence:CCGGGCTGAAGTGCAGAGTGAGATTCTCGAGAATCTCACTCTGCACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1450s21c1
Sequence:CCGGCTGGCTGAATACTTAGAGGTTCTCGAGAACCTCTAAGTATTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007581.2-1000s21c1
Sequence:CCGGGCGCTCTTCGACTTCCTTAAACTCGAGTTTAAGGAAGTCGAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007581.2-2557s21c1
Sequence:CCGGCCCTTGCTCTTCTCATTCTTTCTCGAGAAAGAATGAGAAGAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-2208s1c1
Sequence:CCGGCCCTTGCTCTTCTCATTCTTTCTCGAGAAAGAATGAGAAGAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-237s1c1
Sequence:CCGGGCATTTGCTGTGAGGACCAATCTCGAGATTGGTCCTCACAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-798s1c1
Sequence:CCGGGCTGAAGTGCAGAGTGAGATTCTCGAGAATCTCACTCTGCACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-1101s1c1
Sequence:CCGGCTGGCTGAATACTTAGAGGTTCTCGAGAACCTCTAAGTATTCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007581.1-651s1c1
Sequence:CCGGGCGCTCTTCGACTTCCTTAAACTCGAGTTTAAGGAAGTCGAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks