EMAIL THIS PAGE TO A FRIEND

CACNB4

calcium channel, voltage-dependent, beta 4 subunit

176 Gene Product Result for
Synonyms: CAB4 CACNLB4 EA5 EIG9 EJM EJM4 EJM6
Gene ID:
Human(785) Summary: This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE) and juvenile myoclonic epilepsy (JME). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(12298) calcium channel, voltage-dependent, beta 4 subunit
Rat(58942) calcium channel, voltage-dependent, beta 4 subunit
chicken(374259) calcium channel, voltage-dependent, beta 4 subunit
domestic cat(101101576) calcium channel, voltage-dependent, beta 4 subunit
cow(282161) calcium channel, voltage-dependent, beta 4 subunit
Horse(100057916) calcium channel, voltage-dependent, beta 4 subunit
dog(609361) calcium channel, voltage-dependent, beta 4 subunit
sheep(101117907) calcium channel, voltage-dependent, beta 4 subunit
domestic guinea pig(100723776) calcium channel, voltage-dependent, beta 4 subunit
naked mole-rat(101723713) calcium channel, voltage-dependent, beta 4 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000726 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086631 MISSION® esiRNA esiRNA human CACNB4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000726 Rosetta Predictions human pricing
NM_001005746 Rosetta Predictions human pricing
NM_001005747 Rosetta Predictions human pricing
NM_001105733 Rosetta Predictions rat pricing
NM_001037099 Rosetta Predictions mouse pricing
NM_146123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158046 predicted 1348
2 SASI_Hs01_00158047 predicted 450
3 SASI_Hs01_00158048 predicted 374
4 SASI_Hs02_00303152 predicted 361
5 SASI_Hs01_00158049 predicted 369
6 SASI_Hs01_00158050 predicted 764
7 SASI_Hs01_00158051 predicted 990
8 SASI_Hs01_00158052 predicted 810
9 SASI_Hs02_00303153 predicted 1451
10 SASI_Hs01_00158053 predicted 930
11 SASI_Hs01_00158054 predicted 739
12 SASI_Hs01_00158055 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236251 predicted 1331
2 SASI_Hs01_00236252 predicted 438
3 SASI_Hs01_00236253 predicted 362
4 SASI_Hs02_00305016 predicted 347
5 SASI_Hs01_00236254 predicted 356
6 SASI_Hs01_00236255 predicted 743
7 SASI_Hs01_00236256 predicted 979
8 SASI_Hs01_00236257 predicted 792
9 SASI_Hs02_00305017 predicted 1427
10 SASI_Hs01_00236258 predicted 915
11 SASI_Hs01_00236259 predicted 721
12 SASI_Hs01_00236260 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151005 predicted 1456
2 SASI_Hs01_00151006 predicted 558
3 SASI_Hs01_00151007 predicted 488
4 SASI_Hs02_00305018 predicted 474
5 SASI_Hs01_00151008 predicted 472
6 SASI_Hs01_00151009 predicted 867
7 SASI_Hs01_00151010 predicted 1093
8 SASI_Hs01_00151011 predicted 916
9 SASI_Hs02_00305019 predicted 1559
10 SASI_Hs01_00151012 predicted 1029
11 SASI_Hs01_00151013 predicted 841
12 SASI_Hs01_00151014 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211996 predicted 1268
2 SASI_Rn02_00211997 predicted 1201
3 SASI_Rn02_00211998 predicted 1209
4 SASI_Rn02_00211999 predicted 1481
5 SASI_Rn02_00212000 predicted 710
6 SASI_Rn02_00212001 predicted 988
7 SASI_Rn02_00212002 predicted 897
8 SASI_Rn02_00212003 predicted 1143
9 SASI_Rn02_00212004 predicted 868
10 SASI_Rn02_00212005 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061825 predicted 1358
2 SASI_Mm01_00061826 predicted 728
3 SASI_Mm01_00061827 predicted 1365
4 SASI_Mm01_00061828 predicted 987
5 SASI_Mm01_00061829 predicted 962
6 SASI_Mm01_00061830 predicted 1225
7 SASI_Mm01_00061831 predicted 1300
8 SASI_Mm01_00061832 predicted 1510
9 SASI_Mm01_00061833 predicted 936
10 SASI_Mm01_00061834 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048283 predicted 1258
2 SASI_Mm01_00048284 predicted 628
3 SASI_Mm01_00048285 predicted 1269
4 SASI_Mm01_00048286 predicted 891
5 SASI_Mm01_00048287 predicted 865
6 SASI_Mm01_00048288 predicted 1132
7 SASI_Mm01_00048289 predicted 1209
8 SASI_Mm01_00048290 predicted 1417
9 SASI_Mm01_00048291 predicted 835
10 SASI_Mm01_00048292 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146123
CACNB4 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 4 subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1093s1c1
Sequence:CCGGCCGCCTGAAATGTTTGATGTTCTCGAGAACATCAAACATTTCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-245s1c1
Sequence:CCGGCGAAGTCCAAACCTGTAGCTTCTCGAGAAGCTACAGGTTTGGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1014s1c1
Sequence:CCGGGCTGATTAAGTCCAGAGGAAACTCGAGTTTCCTCTGGACTTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1261s1c1
Sequence:CCGGCCCACAGCAATCTCTGGATTACTCGAGTAATCCAGAGATTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-346s1c1
Sequence:CCGGGCCAAGGACTTTCTTCACATTCTCGAGAATGTGAAGAAAGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146123
CACNB4 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 4 subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1093s1c1
Sequence:CCGGCCGCCTGAAATGTTTGATGTTCTCGAGAACATCAAACATTTCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-245s1c1
Sequence:CCGGCGAAGTCCAAACCTGTAGCTTCTCGAGAAGCTACAGGTTTGGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1014s1c1
Sequence:CCGGGCTGATTAAGTCCAGAGGAAACTCGAGTTTCCTCTGGACTTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1261s1c1
Sequence:CCGGCCCACAGCAATCTCTGGATTACTCGAGTAATCCAGAGATTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-346s1c1
Sequence:CCGGGCCAAGGACTTTCTTCACATTCTCGAGAATGTGAAGAAAGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146123
CACNB4 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 4 subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1093s1c1
Sequence:CCGGCCGCCTGAAATGTTTGATGTTCTCGAGAACATCAAACATTTCAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-245s1c1
Sequence:CCGGCGAAGTCCAAACCTGTAGCTTCTCGAGAAGCTACAGGTTTGGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1014s1c1
Sequence:CCGGGCTGATTAAGTCCAGAGGAAACTCGAGTTTCCTCTGGACTTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-1261s1c1
Sequence:CCGGCCCACAGCAATCTCTGGATTACTCGAGTAATCCAGAGATTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146123.1-346s1c1
Sequence:CCGGGCCAAGGACTTTCTTCACATTCTCGAGAATGTGAAGAAAGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000726
VALIDATED
CACNB4 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, beta 4 subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-528s1c1
Sequence:CCGGCCACTCAGATTGGAGAACATACTCGAGTATGTTCTCCAATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-1050s1c1
Sequence:CCGGGCACCAATTATTGTTCATGTACTCGAGTACATGAACAATAATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-282s1c1
Sequence:CCGGGCAATTCGACAGGAGAGAGAACTCGAGTTCTCTCTCCTGTCGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-584s1c1
Sequence:CCGGCGGAGGGAAATCAAGTGGAAACTCGAGTTTCCACTTGATTTCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-936s1c1
Sequence:CCGGGCGGAAGTACAAAGTGAAATTCTCGAGAATTTCACTTTGTACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-1570s21c1
Sequence:CCGGACATAGGCTTTGAGTCTAATGCTCGAGCATTAGACTCAAAGCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000726.2-1746s21c1
Sequence:CCGGCTTGAGTCTAGATGGATATTACTCGAGTAATATCCATCTAGACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000726.2-656s21c1
Sequence:CCGGTACGATGTTGTACCGTCAATGCTCGAGCATTGACGGTACAACATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-1453s21c1
Sequence:CCGGTCAGCATAGCCGAGATCATTACTCGAGTAATGATCTCGGCTATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-816s21c1
Sequence:CCGGCTAAGAGGTCTGTCCTAAATACTCGAGTATTTAGGACAGACCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000726
VALIDATED
CACNB4 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, beta 4 subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-528s1c1
Sequence:CCGGCCACTCAGATTGGAGAACATACTCGAGTATGTTCTCCAATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-1050s1c1
Sequence:CCGGGCACCAATTATTGTTCATGTACTCGAGTACATGAACAATAATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-282s1c1
Sequence:CCGGGCAATTCGACAGGAGAGAGAACTCGAGTTCTCTCTCCTGTCGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-584s1c1
Sequence:CCGGCGGAGGGAAATCAAGTGGAAACTCGAGTTTCCACTTGATTTCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-936s1c1
Sequence:CCGGGCGGAAGTACAAAGTGAAATTCTCGAGAATTTCACTTTGTACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-1570s21c1
Sequence:CCGGACATAGGCTTTGAGTCTAATGCTCGAGCATTAGACTCAAAGCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000726.2-1746s21c1
Sequence:CCGGCTTGAGTCTAGATGGATATTACTCGAGTAATATCCATCTAGACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000726.2-656s21c1
Sequence:CCGGTACGATGTTGTACCGTCAATGCTCGAGCATTGACGGTACAACATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-1453s21c1
Sequence:CCGGTCAGCATAGCCGAGATCATTACTCGAGTAATGATCTCGGCTATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-816s21c1
Sequence:CCGGCTAAGAGGTCTGTCCTAAATACTCGAGTATTTAGGACAGACCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000726
VALIDATED
CACNB4 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, beta 4 subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-528s1c1
Sequence:CCGGCCACTCAGATTGGAGAACATACTCGAGTATGTTCTCCAATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-1050s1c1
Sequence:CCGGGCACCAATTATTGTTCATGTACTCGAGTACATGAACAATAATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-282s1c1
Sequence:CCGGGCAATTCGACAGGAGAGAGAACTCGAGTTCTCTCTCCTGTCGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-584s1c1
Sequence:CCGGCGGAGGGAAATCAAGTGGAAACTCGAGTTTCCACTTGATTTCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000726.1-936s1c1
Sequence:CCGGGCGGAAGTACAAAGTGAAATTCTCGAGAATTTCACTTTGTACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-1570s21c1
Sequence:CCGGACATAGGCTTTGAGTCTAATGCTCGAGCATTAGACTCAAAGCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000726.2-1746s21c1
Sequence:CCGGCTTGAGTCTAGATGGATATTACTCGAGTAATATCCATCTAGACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000726.2-656s21c1
Sequence:CCGGTACGATGTTGTACCGTCAATGCTCGAGCATTGACGGTACAACATCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-1453s21c1
Sequence:CCGGTCAGCATAGCCGAGATCATTACTCGAGTAATGATCTCGGCTATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000726.2-816s21c1
Sequence:CCGGCTAAGAGGTCTGTCCTAAATACTCGAGTATTTAGGACAGACCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks