EMAIL THIS PAGE TO A FRIEND

CACNG1

calcium channel, voltage-dependent, gamma subunit 1

Synonyms: CACNLG
UniProtKB ID: Q06432, B2R9N3, Q14D59
Gene ID:
Human(786) Summary: Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is part of skeletal muscle 1,4-dihydropyridine-sensitive calcium channels and is an integral membrane protein that plays a role in excitation-contraction coupling. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). [provided by RefSeq, Dec 2010]
Mouse(12299) calcium channel, voltage-dependent, gamma subunit 1
Rat(29658) calcium channel, voltage-dependent, gamma subunit 1
Zebrafish(322013) calcium channel, voltage-dependent, gamma subunit 1
domestic cat(101101520) calcium channel, voltage-dependent, gamma subunit 1
cow(781184) calcium channel, voltage-dependent, gamma subunit 1
dog(610892) calcium channel, voltage-dependent, gamma subunit 1
chicken(417428) calcium channel, voltage-dependent, gamma subunit 1
naked mole-rat(101714630) calcium channel, voltage-dependent, gamma subunit 1
domestic guinea pig(100720127) calcium channel, voltage-dependent, gamma subunit 1
sheep(101110606) calcium channel, voltage-dependent, gamma subunit 1
Domestic Rabbit(100009263) calcium channel, voltage-dependent, gamma subunit 1
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
N149 Nimodipine human, rat pricing
N144 Nitrendipine >95%, powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000727 Rosetta Predictions human pricing
NM_019255 Rosetta Predictions rat pricing
NM_007582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129416 predicted 304
2 SASI_Hs01_00129417 predicted 1044
3 SASI_Hs01_00129418 predicted 937
4 SASI_Hs01_00129421 predicted 915
5 SASI_Hs01_00129422 predicted 590
6 SASI_Hs01_00129423 predicted 229
7 SASI_Hs01_00129424 predicted 572
8 SASI_Hs01_00129425 predicted 555
9 SASI_Hs02_00303154 predicted 531
10 SASI_Hs02_00303155 predicted 451
11 SASI_Hs01_00129419 predicted 1035
12 SASI_Hs01_00129420 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262133 predicted 275
2 SASI_Rn01_00116204 predicted 585
3 SASI_Rn01_00116205 predicted 383
4 SASI_Rn01_00116207 predicted 242
5 SASI_Rn01_00116208 predicted 199
6 SASI_Rn01_00116209 predicted 377
7 SASI_Rn01_00116210 predicted 395
8 SASI_Rn01_00116212 predicted 416
9 SASI_Rn02_00262134 predicted 417
10 SASI_Rn02_00262135 predicted 580
11 SASI_Rn01_00116203 predicted 311
12 SASI_Rn01_00116206 predicted 359
13 SASI_Rn01_00116211 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132460 predicted 969
2 SASI_Mm01_00132461 predicted 322
3 SASI_Mm01_00132462 predicted 980
4 SASI_Mm01_00132463 predicted 605
5 SASI_Mm01_00132464 predicted 534
6 SASI_Mm01_00132465 predicted 406
7 SASI_Mm01_00132466 predicted 550
8 SASI_Mm01_00132467 predicted 358
9 SASI_Mm01_00132468 predicted 284
10 SASI_Mm02_00311976 predicted 798
11 SASI_Mm01_00132459 predicted 812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000727
CACNG1 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000727.2-554s21c1
Sequence:CCGGGGTGAAGCGCATGATTGACAGCTCGAGCTGTCAATCATGCGCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000727.2-922s21c1
Sequence:CCGGGAATAGAGCAAGACGTGAGTCCTCGAGGACTCACGTCTTGCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000727.2-1081s21c1
Sequence:CCGGTGCAGGGACAACCTGTGTTTGCTCGAGCAAACACAGGTTGTCCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000727.2-233s1c1
Sequence:CCGGGCGGATTTGTACCAAGCGCATCTCGAGATGCGCTTGGTACAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000727.2-583s1c1
Sequence:CCGGCCGTCTGGATCGAGTACTATTCTCGAGAATAGTACTCGATCCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000727
CACNG1 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000727.2-554s21c1
Sequence:CCGGGGTGAAGCGCATGATTGACAGCTCGAGCTGTCAATCATGCGCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000727.2-922s21c1
Sequence:CCGGGAATAGAGCAAGACGTGAGTCCTCGAGGACTCACGTCTTGCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000727.2-1081s21c1
Sequence:CCGGTGCAGGGACAACCTGTGTTTGCTCGAGCAAACACAGGTTGTCCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000727.2-233s1c1
Sequence:CCGGGCGGATTTGTACCAAGCGCATCTCGAGATGCGCTTGGTACAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000727.2-583s1c1
Sequence:CCGGCCGTCTGGATCGAGTACTATTCTCGAGAATAGTACTCGATCCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000727
CACNG1 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000727.2-554s21c1
Sequence:CCGGGGTGAAGCGCATGATTGACAGCTCGAGCTGTCAATCATGCGCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000727.2-922s21c1
Sequence:CCGGGAATAGAGCAAGACGTGAGTCCTCGAGGACTCACGTCTTGCTCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000727.2-1081s21c1
Sequence:CCGGTGCAGGGACAACCTGTGTTTGCTCGAGCAAACACAGGTTGTCCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000727.2-233s1c1
Sequence:CCGGGCGGATTTGTACCAAGCGCATCTCGAGATGCGCTTGGTACAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000727.2-583s1c1
Sequence:CCGGCCGTCTGGATCGAGTACTATTCTCGAGAATAGTACTCGATCCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007582
CACNG1 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007582.2-199s21c1
Sequence:CCGGCCTGGAGCACCACAATGAAACCTCGAGGTTTCATTGTGGTGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007582.2-446s21c1
Sequence:CCGGGTGGGTTCCATCTGCGCATTTCTCGAGAAATGCGCAGATGGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007582.2-897s21c1
Sequence:CCGGAGCAGGCCAGCAGGTATATGACTCGAGTCATATACCTGCTGGCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-517s1c1
Sequence:CCGGCCTTCGGGAATAAGCGTGATTCTCGAGAATCACGCTTATTCCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-612s1c1
Sequence:CCGGCAGTCGGTGAAGCGTATGATTCTCGAGAATCATACGCTTCACCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-648s1c1
Sequence:CCGGGTCTGGATAGAGCACTACTATCTCGAGATAGTAGTGCTCTATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-319s1c1
Sequence:CCGGTGCACAACAAAGACAAGAGTTCTCGAGAACTCTTGTCTTTGTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-374s1c1
Sequence:CCGGCTCCTACTTCAGGCACTTCAACTCGAGTTGAAGTGCCTGAAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007582
CACNG1 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007582.2-199s21c1
Sequence:CCGGCCTGGAGCACCACAATGAAACCTCGAGGTTTCATTGTGGTGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007582.2-446s21c1
Sequence:CCGGGTGGGTTCCATCTGCGCATTTCTCGAGAAATGCGCAGATGGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007582.2-897s21c1
Sequence:CCGGAGCAGGCCAGCAGGTATATGACTCGAGTCATATACCTGCTGGCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-517s1c1
Sequence:CCGGCCTTCGGGAATAAGCGTGATTCTCGAGAATCACGCTTATTCCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-612s1c1
Sequence:CCGGCAGTCGGTGAAGCGTATGATTCTCGAGAATCATACGCTTCACCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-648s1c1
Sequence:CCGGGTCTGGATAGAGCACTACTATCTCGAGATAGTAGTGCTCTATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-319s1c1
Sequence:CCGGTGCACAACAAAGACAAGAGTTCTCGAGAACTCTTGTCTTTGTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-374s1c1
Sequence:CCGGCTCCTACTTCAGGCACTTCAACTCGAGTTGAAGTGCCTGAAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007582
CACNG1 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007582.2-199s21c1
Sequence:CCGGCCTGGAGCACCACAATGAAACCTCGAGGTTTCATTGTGGTGCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007582.2-446s21c1
Sequence:CCGGGTGGGTTCCATCTGCGCATTTCTCGAGAAATGCGCAGATGGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007582.2-897s21c1
Sequence:CCGGAGCAGGCCAGCAGGTATATGACTCGAGTCATATACCTGCTGGCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-517s1c1
Sequence:CCGGCCTTCGGGAATAAGCGTGATTCTCGAGAATCACGCTTATTCCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-612s1c1
Sequence:CCGGCAGTCGGTGAAGCGTATGATTCTCGAGAATCATACGCTTCACCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-648s1c1
Sequence:CCGGGTCTGGATAGAGCACTACTATCTCGAGATAGTAGTGCTCTATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-319s1c1
Sequence:CCGGTGCACAACAAAGACAAGAGTTCTCGAGAACTCTTGTCTTTGTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007582.1-374s1c1
Sequence:CCGGCTCCTACTTCAGGCACTTCAACTCGAGTTGAAGTGCCTGAAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks