EMAIL THIS PAGE TO A FRIEND

CACNG2

calcium channel, voltage-dependent, gamma subunit 2

93 Gene Product Result for
Synonyms: MRD10
UniProtKB ID: Q9Y698, Q2M1M1, Q5TGT3, Q9UGZ7
Gene ID:
Human(10369) Summary: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family. This gene is a susceptibility locus for schizophrenia. [provided by RefSeq, Dec 2010]
Mouse(12300) calcium channel, voltage-dependent, gamma subunit 2
Rat(84347) calcium channel, voltage-dependent, gamma subunit 2
sheep(101122427) calcium channel, voltage-dependent, gamma subunit 2
domestic guinea pig(100719693) calcium channel, voltage-dependent, gamma subunit 2
naked mole-rat(101700752) calcium channel, voltage-dependent, gamma subunit 2
chicken(427909) calcium channel, voltage-dependent, gamma subunit 2
cow(286800) calcium channel, voltage-dependent, gamma subunit 2
domestic cat(101094770) calcium channel, voltage-dependent, gamma subunit 2
dog(481279) calcium channel, voltage-dependent, gamma subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1401520 Anti-CACNG2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2700909 Anti-CACNG2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2106359 Anti-CACNG2 antibody produced in rabbit affinity isolated antibody human, rat, guinea pig, horse, rabbit
ELISA, western blot pricing
C8206 Anti-Calcium Channel (γ2 Subunit) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
immunohistochemistry, western blot pricing
SAB5200753 Monoclonal Anti-Tarp - Alkaline Phosphatase antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200754 Monoclonal Anti-Tarp - Apc antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200745 Monoclonal Anti-Tarp - Atto 390 antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200746 Monoclonal Anti-Tarp - Atto 488 antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200747 Monoclonal Anti-Tarp - Atto 565 antibody produced in mouse clone S245-1, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200748 Monoclonal Anti-Tarp - Atto 594 antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200749 Monoclonal Anti-Tarp - Atto 633 antibody produced in mouse clone S245-1, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200750 Monoclonal Anti-Tarp - Atto 655 antibody produced in mouse clone S245-1, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200751 Monoclonal Anti-Tarp - Atto 680 antibody produced in mouse clone S245-1, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200752 Monoclonal Anti-Tarp - Atto 700 antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200755 Monoclonal Anti-Tarp - Biotin antibody produced in mouse clone S245-1, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200756 Monoclonal Anti-Tarp - Fitc antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200757 Monoclonal Anti-Tarp - Hrp antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200758 Monoclonal Anti-Tarp - Pe/Atto 594 antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200759 Monoclonal Anti-Tarp - Percp antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200760 Monoclonal Anti-Tarp - Rpe antibody produced in mouse clone S245-1, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200761 Monoclonal Anti-Tarp - Streptavidin antibody produced in mouse clone S245-1, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200762 Monoclonal Anti-Tarp antibody produced in mouse clone S245-36, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200771 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Alkaline Phosphatase antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200772 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Apc antibody produced in mouse clone S245-36, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200763 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 390 antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200764 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 488 antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200765 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 565 antibody produced in mouse clone S245-36, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200766 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 594 antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200767 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 633 antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200768 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 655 antibody produced in mouse clone S245-36, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200769 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 680 antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200770 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Atto 700 antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200773 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Biotin antibody produced in mouse clone S245-36, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200774 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Fitc antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200775 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Hrp antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200776 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Pe/Atto 594 antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200777 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Percp antibody produced in mouse clone S245-36, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200778 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Rpe antibody produced in mouse clone S245-36, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200779 Monoclonal Anti-Tarp Gamma2/4/8 (Stargazin) - Streptavidin antibody produced in mouse clone S245-36, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200744 Monoclonal Anti-Tarp Gamma2/Stargazin antibody produced in mouse clone S245-1, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006078 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042601 MISSION® esiRNA esiRNA human CACNG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006078 Rosetta Predictions human pricing
NM_053351 Rosetta Predictions rat pricing
NM_007583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024657 predicted 771
2 SASI_Hs01_00024658 predicted 441
3 SASI_Hs01_00024659 predicted 455
4 SASI_Hs01_00024660 predicted 728
5 SASI_Hs01_00024661 predicted 680
6 SASI_Hs01_00024662 predicted 702
7 SASI_Hs01_00024663 predicted 449
8 SASI_Hs01_00024664 predicted 510
9 SASI_Hs01_00024665 predicted 440
10 SASI_Hs01_00024666 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059324 predicted 361
2 SASI_Rn01_00059325 predicted 300
3 SASI_Rn01_00059326 predicted 194
4 SASI_Rn01_00059327 predicted 487
5 SASI_Rn01_00059328 predicted 257
6 SASI_Rn01_00059329 predicted 451
7 SASI_Rn01_00059330 predicted 466
8 SASI_Rn01_00059331 predicted 673
9 SASI_Rn01_00059332 predicted 292
10 SASI_Rn01_00059333 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086271 predicted 812
2 SASI_Mm01_00086272 predicted 632
3 SASI_Mm02_00311977 predicted 388
4 SASI_Mm01_00086273 predicted 553
5 SASI_Mm01_00086274 predicted 657
6 SASI_Mm02_00311978 predicted 418
7 SASI_Mm01_00086275 predicted 649
8 SASI_Mm01_00086277 predicted 613
9 SASI_Mm02_00311979 predicted 435
10 SASI_Mm01_00086278 predicted 877
11 SASI_Mm01_00086276 predicted 813
12 SASI_Mm01_00086279 predicted 547
13 SASI_Mm01_00086280 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007583
CACNG2 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007583.1-1373s1c1
Sequence:CCGGCGGGGGACCCTGGGGAGGCTTCTCGAGAAGCCTCCCCAGGGTCCCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-839s1c1
Sequence:CCGGCATCGGGATCATCGTGTATATCTCGAGATATACACGATGATCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-608s1c1
Sequence:CCGGCAAAGGTCTGTGCAAGCAAATCTCGAGATTTGCTTGCACAGACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-1286s1c1
Sequence:CCGGCCACAACTGTATCCAGAAGGACTCGAGTCCTTCTGGATACAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-541s1c1
Sequence:CCGGGCAAGAAGAACGAGGAAGTTACTCGAGTAACTTCCTCGTTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007583.2-659s21c1
Sequence:CCGGAGCTGACACCGCAGAGTATTTCTCGAGAAATACTCTGCGGTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007583.2-466s21c1
Sequence:CCGGTCGCTGTGGGAACCGACTATTCTCGAGAATAGTCGGTTCCCACAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007583
CACNG2 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007583.1-1373s1c1
Sequence:CCGGCGGGGGACCCTGGGGAGGCTTCTCGAGAAGCCTCCCCAGGGTCCCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-839s1c1
Sequence:CCGGCATCGGGATCATCGTGTATATCTCGAGATATACACGATGATCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-608s1c1
Sequence:CCGGCAAAGGTCTGTGCAAGCAAATCTCGAGATTTGCTTGCACAGACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-1286s1c1
Sequence:CCGGCCACAACTGTATCCAGAAGGACTCGAGTCCTTCTGGATACAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-541s1c1
Sequence:CCGGGCAAGAAGAACGAGGAAGTTACTCGAGTAACTTCCTCGTTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007583.2-659s21c1
Sequence:CCGGAGCTGACACCGCAGAGTATTTCTCGAGAAATACTCTGCGGTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007583.2-466s21c1
Sequence:CCGGTCGCTGTGGGAACCGACTATTCTCGAGAATAGTCGGTTCCCACAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007583
CACNG2 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007583.1-1373s1c1
Sequence:CCGGCGGGGGACCCTGGGGAGGCTTCTCGAGAAGCCTCCCCAGGGTCCCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-839s1c1
Sequence:CCGGCATCGGGATCATCGTGTATATCTCGAGATATACACGATGATCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-608s1c1
Sequence:CCGGCAAAGGTCTGTGCAAGCAAATCTCGAGATTTGCTTGCACAGACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-1286s1c1
Sequence:CCGGCCACAACTGTATCCAGAAGGACTCGAGTCCTTCTGGATACAGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007583.1-541s1c1
Sequence:CCGGGCAAGAAGAACGAGGAAGTTACTCGAGTAACTTCCTCGTTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007583.2-659s21c1
Sequence:CCGGAGCTGACACCGCAGAGTATTTCTCGAGAAATACTCTGCGGTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007583.2-466s21c1
Sequence:CCGGTCGCTGTGGGAACCGACTATTCTCGAGAATAGTCGGTTCCCACAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006078
CACNG2 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006078.2-1334s1c1
Sequence:CCGGTCCGCTGGGAGACCTTCCAAACTCGAGTTTGGAAGGTCTCCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-715s1c1
Sequence:CCGGGCAGGTCTGAGTAACATCATTCTCGAGAATGATGTTACTCAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-443s1c1
Sequence:CCGGACGAGGAAGTTATGACCCATTCTCGAGAATGGGTCATAACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-532s1c1
Sequence:CCGGCCAGAGGATGCAGATTACGAACTCGAGTTCGTAATCTGCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-1170s1c1
Sequence:CCGGCCTCCAGGTTCACAACTGTATCTCGAGATACAGTTGTGAACCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006078
CACNG2 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006078.2-1334s1c1
Sequence:CCGGTCCGCTGGGAGACCTTCCAAACTCGAGTTTGGAAGGTCTCCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-715s1c1
Sequence:CCGGGCAGGTCTGAGTAACATCATTCTCGAGAATGATGTTACTCAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-443s1c1
Sequence:CCGGACGAGGAAGTTATGACCCATTCTCGAGAATGGGTCATAACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-532s1c1
Sequence:CCGGCCAGAGGATGCAGATTACGAACTCGAGTTCGTAATCTGCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-1170s1c1
Sequence:CCGGCCTCCAGGTTCACAACTGTATCTCGAGATACAGTTGTGAACCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006078
CACNG2 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006078.2-1334s1c1
Sequence:CCGGTCCGCTGGGAGACCTTCCAAACTCGAGTTTGGAAGGTCTCCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-715s1c1
Sequence:CCGGGCAGGTCTGAGTAACATCATTCTCGAGAATGATGTTACTCAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-443s1c1
Sequence:CCGGACGAGGAAGTTATGACCCATTCTCGAGAATGGGTCATAACTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-532s1c1
Sequence:CCGGCCAGAGGATGCAGATTACGAACTCGAGTTCGTAATCTGCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006078.2-1170s1c1
Sequence:CCGGCCTCCAGGTTCACAACTGTATCTCGAGATACAGTTGTGAACCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks