EMAIL THIS PAGE TO A FRIEND

CACNG3

calcium channel, voltage-dependent, gamma subunit 3

78 Gene Product Result for
UniProtKB ID: O60359
Gene ID:
Human(10368) Summary: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family. This gene is a susceptibility locus for childhood absence epilepsy. [provided by RefSeq, Dec 2010]
Mouse(54376) calcium channel, voltage-dependent, gamma subunit 3
Rat(140724) calcium channel, voltage-dependent, gamma subunit 3
chicken(395378) calcium channel, voltage-dependent, gamma subunit 3
cow(538496) calcium channel, voltage-dependent, gamma subunit 3
domestic cat(101098273) calcium channel, voltage-dependent, gamma subunit 3
dog(489967) calcium channel, voltage-dependent, gamma subunit 3
naked mole-rat(101723508) calcium channel, voltage-dependent, gamma subunit 3
domestic guinea pig(100722578) calcium channel, voltage-dependent, gamma subunit 3
sheep(101105970) calcium channel, voltage-dependent, gamma subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006539 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150711 MISSION® esiRNA esiRNA human CACNG3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006539 Rosetta Predictions human pricing
NM_080691 Rosetta Predictions rat pricing
NM_019430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341796 predicted 2370
2 SASI_Hs01_00019942 predicted 1351
3 SASI_Hs01_00019943 predicted 1322
4 SASI_Hs01_00019944 predicted 1321
5 SASI_Hs01_00019945 predicted 2225
6 SASI_Hs01_00019947 predicted 1286
7 SASI_Hs01_00019948 predicted 1599
8 SASI_Hs01_00019949 predicted 1288
9 SASI_Hs01_00019950 predicted 2091
10 SASI_Hs01_00019951 predicted 1213
11 SASI_Hs01_00019946 predicted 1716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267276 predicted 700
2 SASI_Rn02_00267277 predicted 630
3 SASI_Rn01_00104176 predicted 376
4 SASI_Rn02_00267278 predicted 698
5 SASI_Rn01_00104178 predicted 263
6 SASI_Rn01_00104179 predicted 245
7 SASI_Rn01_00104180 predicted 690
8 SASI_Rn01_00104181 predicted 415
9 SASI_Rn01_00104182 predicted 377
10 SASI_Rn01_00104183 predicted 709
11 SASI_Rn01_00104175 predicted 583
12 SASI_Rn01_00104177 predicted 220
13 SASI_Rn01_00104184 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083895 predicted 212
2 SASI_Mm01_00083896 predicted 700
3 SASI_Mm01_00083897 predicted 702
4 SASI_Mm01_00083898 predicted 631
5 SASI_Mm01_00083899 predicted 261
6 SASI_Mm01_00083900 predicted 448
7 SASI_Mm01_00083901 predicted 239
8 SASI_Mm01_00083903 predicted 695
9 SASI_Mm01_00083904 predicted 414
10 SASI_Mm02_00324366 predicted 549
11 SASI_Mm01_00083902 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006539
CACNG3 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006539.2-2226s21c1
Sequence:CCGGATGGTCCTTGTGATGGTATTACTCGAGTAATACCATCACAAGGACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1311s21c1
Sequence:CCGGAGGTGTGTGCAGGACTAAATCCTCGAGGATTTAGTCCTGCACACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1468s21c1
Sequence:CCGGGAACAGGACACAGCCGAATATCTCGAGATATTCGGCTGTGTCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1586s21c1
Sequence:CCGGGCAGCAGACACAACGTCATTCCTCGAGGAATGACGTTGTGTCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006539.2-2522s21c1
Sequence:CCGGCCATTGTCTACCCACACAAATCTCGAGATTTGTGTGGGTAGACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1352s1c1
Sequence:CCGGGCAGGAAGAATGAAGAAGTAACTCGAGTTACTTCTTCATTCTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-2070s1c1
Sequence:CCGGGTTCCACAATTCCACACCCAACTCGAGTTGGGTGTGGAATTGTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1786s1c1
Sequence:CCGGGCCGTGCACATCTATATTGAACTCGAGTTCAATATAGATGTGCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1765s1c1
Sequence:CCGGGCAGAAATTGTAGGAGTGGTTCTCGAGAACCACTCCTACAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1286s1c1
Sequence:CCGGGCACGGACTACTGGTTATATTCTCGAGAATATAACCAGTAGTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006539
CACNG3 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006539.2-2226s21c1
Sequence:CCGGATGGTCCTTGTGATGGTATTACTCGAGTAATACCATCACAAGGACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1311s21c1
Sequence:CCGGAGGTGTGTGCAGGACTAAATCCTCGAGGATTTAGTCCTGCACACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1468s21c1
Sequence:CCGGGAACAGGACACAGCCGAATATCTCGAGATATTCGGCTGTGTCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1586s21c1
Sequence:CCGGGCAGCAGACACAACGTCATTCCTCGAGGAATGACGTTGTGTCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006539.2-2522s21c1
Sequence:CCGGCCATTGTCTACCCACACAAATCTCGAGATTTGTGTGGGTAGACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1352s1c1
Sequence:CCGGGCAGGAAGAATGAAGAAGTAACTCGAGTTACTTCTTCATTCTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-2070s1c1
Sequence:CCGGGTTCCACAATTCCACACCCAACTCGAGTTGGGTGTGGAATTGTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1786s1c1
Sequence:CCGGGCCGTGCACATCTATATTGAACTCGAGTTCAATATAGATGTGCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1765s1c1
Sequence:CCGGGCAGAAATTGTAGGAGTGGTTCTCGAGAACCACTCCTACAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1286s1c1
Sequence:CCGGGCACGGACTACTGGTTATATTCTCGAGAATATAACCAGTAGTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006539
CACNG3 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006539.2-2226s21c1
Sequence:CCGGATGGTCCTTGTGATGGTATTACTCGAGTAATACCATCACAAGGACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1311s21c1
Sequence:CCGGAGGTGTGTGCAGGACTAAATCCTCGAGGATTTAGTCCTGCACACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1468s21c1
Sequence:CCGGGAACAGGACACAGCCGAATATCTCGAGATATTCGGCTGTGTCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006539.2-1586s21c1
Sequence:CCGGGCAGCAGACACAACGTCATTCCTCGAGGAATGACGTTGTGTCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006539.2-2522s21c1
Sequence:CCGGCCATTGTCTACCCACACAAATCTCGAGATTTGTGTGGGTAGACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1352s1c1
Sequence:CCGGGCAGGAAGAATGAAGAAGTAACTCGAGTTACTTCTTCATTCTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-2070s1c1
Sequence:CCGGGTTCCACAATTCCACACCCAACTCGAGTTGGGTGTGGAATTGTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1786s1c1
Sequence:CCGGGCCGTGCACATCTATATTGAACTCGAGTTCAATATAGATGTGCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1765s1c1
Sequence:CCGGGCAGAAATTGTAGGAGTGGTTCTCGAGAACCACTCCTACAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006539.2-1286s1c1
Sequence:CCGGGCACGGACTACTGGTTATATTCTCGAGAATATAACCAGTAGTCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019430
CACNG3 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-677s1c1
Sequence:CCGGCCTACAGGTATAGATTCCGAACTCGAGTTCGGAATCTATACCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-438s1c1
Sequence:CCGGGCTAAGCAACATCATCGGCATCTCGAGATGCCGATGATGTTGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-588s1c1
Sequence:CCGGCGTGCACATCTATATCGAGAACTCGAGTTCTCGATATAGATGTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-123s1c1
Sequence:CCGGGACTAAATCTACAAGTGACAACTCGAGTTGTCACTTGTAGATTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-642s1c1
Sequence:CCGGGCTCCTGAAGAAGTCTACATTCTCGAGAATGTAGACTTCTTCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019430
CACNG3 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-677s1c1
Sequence:CCGGCCTACAGGTATAGATTCCGAACTCGAGTTCGGAATCTATACCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-438s1c1
Sequence:CCGGGCTAAGCAACATCATCGGCATCTCGAGATGCCGATGATGTTGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-588s1c1
Sequence:CCGGCGTGCACATCTATATCGAGAACTCGAGTTCTCGATATAGATGTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-123s1c1
Sequence:CCGGGACTAAATCTACAAGTGACAACTCGAGTTGTCACTTGTAGATTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-642s1c1
Sequence:CCGGGCTCCTGAAGAAGTCTACATTCTCGAGAATGTAGACTTCTTCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019430
CACNG3 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-677s1c1
Sequence:CCGGCCTACAGGTATAGATTCCGAACTCGAGTTCGGAATCTATACCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-438s1c1
Sequence:CCGGGCTAAGCAACATCATCGGCATCTCGAGATGCCGATGATGTTGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-588s1c1
Sequence:CCGGCGTGCACATCTATATCGAGAACTCGAGTTCTCGATATAGATGTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-123s1c1
Sequence:CCGGGACTAAATCTACAAGTGACAACTCGAGTTGTCACTTGTAGATTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019430.1-642s1c1
Sequence:CCGGGCTCCTGAAGAAGTCTACATTCTCGAGAATGTAGACTTCTTCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)