EMAIL THIS PAGE TO A FRIEND

CACNG4

calcium channel, voltage-dependent, gamma subunit 4

69 Gene Product Result for
UniProtKB ID: Q9UBN1, B2RCK0
Gene ID:
Human(27092) Summary: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type II TARP and a calcium channel gamma subunit. [provided by RefSeq, Dec 2010]
Mouse(54377) calcium channel, voltage-dependent, gamma subunit 4
Rat(140725) calcium channel, voltage-dependent, gamma subunit 4
chicken(373924) calcium channel, voltage-dependent, gamma subunit 4
cow(519331) calcium channel, voltage-dependent, gamma subunit 4
dog(480463) calcium channel, voltage-dependent, gamma subunit 4
domestic cat(101086189) calcium channel, voltage-dependent, gamma subunit 4
domestic guinea pig(100713348) calcium channel, voltage-dependent, gamma subunit 4
naked mole-rat(101714984) calcium channel, voltage-dependent, gamma subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014405 Rosetta Predictions human pricing
NM_080692 Rosetta Predictions rat pricing
NM_019431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036876 predicted 1321
2 SASI_Hs01_00036877 predicted 482
3 SASI_Hs01_00036878 predicted 510
4 SASI_Hs02_00345592 predicted 470
5 SASI_Hs02_00345593 predicted 1318
6 SASI_Hs01_00036880 predicted 460
7 SASI_Hs01_00036881 predicted 1080
8 SASI_Hs01_00036882 predicted 1184
9 SASI_Hs01_00036883 predicted 654
10 SASI_Hs01_00036884 predicted 1289
11 SASI_Hs01_00036879 predicted 617
12 SASI_Hs01_00036885 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048109 predicted 633
2 SASI_Rn02_00267279 predicted 600
3 SASI_Rn01_00048110 predicted 410
4 SASI_Rn01_00048111 predicted 254
5 SASI_Rn01_00048112 predicted 288
6 SASI_Rn01_00048113 predicted 499
7 SASI_Rn01_00048114 predicted 377
8 SASI_Rn01_00048115 predicted 550
9 SASI_Rn01_00048116 predicted 449
10 SASI_Rn01_00048117 predicted 237
11 SASI_Rn01_00048118 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127452 predicted 643
2 SASI_Mm02_00324367 predicted 502
3 SASI_Mm01_00127454 predicted 382
4 SASI_Mm01_00127455 predicted 599
5 SASI_Mm01_00127456 predicted 647
6 SASI_Mm01_00127457 predicted 498
7 SASI_Mm01_00127458 predicted 557
8 SASI_Mm01_00127459 predicted 453
9 SASI_Mm01_00127460 predicted 493
10 SASI_Mm01_00127461 predicted 284
11 SASI_Mm01_00127453 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019431
CACNG4 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-447s1c1
Sequence:CCGGCCTCAGTAATATCATCGGTATCTCGAGATACCGATGATATTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-600s1c1
Sequence:CCGGCCTGGCTGTAAACATTTACATCTCGAGATGTAAATGTTTACAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-786s1c1
Sequence:CCGGCCTGAAGATCACCGGAGCCATCTCGAGATGGCTCCGGTGATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-642s1c1
Sequence:CCGGGTTTAAGACCAAGCGGGAGTTCTCGAGAACTCCCGCTTGGTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-209s1c1
Sequence:CCGGGTTGCATCGAAGGCATCTATACTCGAGTATAGATGCCTTCGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019431
CACNG4 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-447s1c1
Sequence:CCGGCCTCAGTAATATCATCGGTATCTCGAGATACCGATGATATTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-600s1c1
Sequence:CCGGCCTGGCTGTAAACATTTACATCTCGAGATGTAAATGTTTACAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-786s1c1
Sequence:CCGGCCTGAAGATCACCGGAGCCATCTCGAGATGGCTCCGGTGATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-642s1c1
Sequence:CCGGGTTTAAGACCAAGCGGGAGTTCTCGAGAACTCCCGCTTGGTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-209s1c1
Sequence:CCGGGTTGCATCGAAGGCATCTATACTCGAGTATAGATGCCTTCGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019431
CACNG4 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-447s1c1
Sequence:CCGGCCTCAGTAATATCATCGGTATCTCGAGATACCGATGATATTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-600s1c1
Sequence:CCGGCCTGGCTGTAAACATTTACATCTCGAGATGTAAATGTTTACAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-786s1c1
Sequence:CCGGCCTGAAGATCACCGGAGCCATCTCGAGATGGCTCCGGTGATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-642s1c1
Sequence:CCGGGTTTAAGACCAAGCGGGAGTTCTCGAGAACTCCCGCTTGGTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019431.1-209s1c1
Sequence:CCGGGTTGCATCGAAGGCATCTATACTCGAGTATAGATGCCTTCGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014405
VALIDATED
CACNG4 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-224s1c1
Sequence:CCGGGCTGCATCGAAGGGATCTATACTCGAGTATAGATCCCTTCGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-474s1c1
Sequence:CCGGCATCGGTATCATCGTCTACATCTCGAGATGTAGACGATGATACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-649s1c1
Sequence:CCGGGAGTTGAGGTTTAAGACCAAACTCGAGTTTGGTCTTAAACCTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014405.2-657s1c1
Sequence:CCGGGTTTAAGACCAAACGGGAATTCTCGAGAATTCCCGTTTGGTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-462s1c1
Sequence:CCGGCCTCAGTAACATCATCGGTATCTCGAGATACCGATGATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-224s21c1
Sequence:CCGGGCTGCATCGAAGGGATCTATACTCGAGTATAGATCCCTTCGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-613s21c1
Sequence:CCGGGTCCTGGCTGTAAACATTTACCTCGAGGTAAATGTTTACAGCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014405.2-1079s21c1
Sequence:CCGGGACGACGAACAATGAACTAAACTCGAGTTTAGTTCATTGTTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-462s21c1
Sequence:CCGGCCTCAGTAACATCATCGGTATCTCGAGATACCGATGATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-649s21c1
Sequence:CCGGGAGTTGAGGTTTAAGACCAAACTCGAGTTTGGTCTTAAACCTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014405
VALIDATED
CACNG4 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-224s1c1
Sequence:CCGGGCTGCATCGAAGGGATCTATACTCGAGTATAGATCCCTTCGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-474s1c1
Sequence:CCGGCATCGGTATCATCGTCTACATCTCGAGATGTAGACGATGATACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-649s1c1
Sequence:CCGGGAGTTGAGGTTTAAGACCAAACTCGAGTTTGGTCTTAAACCTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014405.2-657s1c1
Sequence:CCGGGTTTAAGACCAAACGGGAATTCTCGAGAATTCCCGTTTGGTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-462s1c1
Sequence:CCGGCCTCAGTAACATCATCGGTATCTCGAGATACCGATGATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-224s21c1
Sequence:CCGGGCTGCATCGAAGGGATCTATACTCGAGTATAGATCCCTTCGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-613s21c1
Sequence:CCGGGTCCTGGCTGTAAACATTTACCTCGAGGTAAATGTTTACAGCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014405.2-1079s21c1
Sequence:CCGGGACGACGAACAATGAACTAAACTCGAGTTTAGTTCATTGTTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-462s21c1
Sequence:CCGGCCTCAGTAACATCATCGGTATCTCGAGATACCGATGATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-649s21c1
Sequence:CCGGGAGTTGAGGTTTAAGACCAAACTCGAGTTTGGTCTTAAACCTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014405
VALIDATED
CACNG4 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-224s1c1
Sequence:CCGGGCTGCATCGAAGGGATCTATACTCGAGTATAGATCCCTTCGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-474s1c1
Sequence:CCGGCATCGGTATCATCGTCTACATCTCGAGATGTAGACGATGATACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-649s1c1
Sequence:CCGGGAGTTGAGGTTTAAGACCAAACTCGAGTTTGGTCTTAAACCTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014405.2-657s1c1
Sequence:CCGGGTTTAAGACCAAACGGGAATTCTCGAGAATTCCCGTTTGGTCTTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014405.2-462s1c1
Sequence:CCGGCCTCAGTAACATCATCGGTATCTCGAGATACCGATGATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-224s21c1
Sequence:CCGGGCTGCATCGAAGGGATCTATACTCGAGTATAGATCCCTTCGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-613s21c1
Sequence:CCGGGTCCTGGCTGTAAACATTTACCTCGAGGTAAATGTTTACAGCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014405.2-1079s21c1
Sequence:CCGGGACGACGAACAATGAACTAAACTCGAGTTTAGTTCATTGTTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-462s21c1
Sequence:CCGGCCTCAGTAACATCATCGGTATCTCGAGATACCGATGATGTTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014405.2-649s21c1
Sequence:CCGGGAGTTGAGGTTTAAGACCAAACTCGAGTTTGGTCTTAAACCTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks