EMAIL THIS PAGE TO A FRIEND

CACNG5

calcium channel, voltage-dependent, gamma subunit 5

UniProtKB ID: Q9UF02, A8K2A6, Q547R3, Q8WXS7, Q9UHM3
Gene ID:
Human(27091) Summary: The protein encoded by this gene is a type II transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type I TARP and a calcium channel gamma subunit. This gene is a susceptibility locus for schizophrenia and bipolar disorder. [provided by RefSeq, Dec 2010]
Mouse(140723) calcium channel, voltage-dependent, gamma subunit 5
Rat(140726) calcium channel, voltage-dependent, gamma subunit 5
naked mole-rat(101715359) calcium channel, voltage-dependent, gamma subunit 5
domestic guinea pig(100720411) calcium channel, voltage-dependent, gamma subunit 5
dog(490905) calcium channel, voltage-dependent, gamma subunit 5
cow(529382) calcium channel, voltage-dependent, gamma subunit 5
domestic cat(101080339) calcium channel, voltage-dependent, gamma subunit 5
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089751 MISSION® esiRNA esiRNA targeting mouse Cacng5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014404 Rosetta Predictions human pricing
NM_145811 Rosetta Predictions human pricing
NM_080693 Rosetta Predictions rat pricing
XM_579606 Rosetta Predictions rat pricing
NM_080644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194563 predicted 205
2 SASI_Hs01_00194564 predicted 204
3 SASI_Hs01_00194565 predicted 259
4 SASI_Hs01_00194566 predicted 256
5 SASI_Hs01_00194567 predicted 263
6 SASI_Hs02_00345591 predicted 266
7 SASI_Hs01_00194569 predicted 246
8 SASI_Hs01_00194570 predicted 259
9 SASI_Hs01_00194571 predicted 205
10 SASI_Hs01_00194572 predicted 294
11 SASI_Hs01_00194568 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149105 predicted 206
2 SASI_Hs01_00149106 predicted 202
3 SASI_Hs01_00149107 predicted 259
4 SASI_Hs01_00149108 predicted 257
5 SASI_Hs01_00149109 predicted 258
6 SASI_Hs02_00365371 predicted 263
7 SASI_Hs01_00149111 predicted 247
8 SASI_Hs01_00149112 predicted 260
9 SASI_Hs01_00149113 predicted 201
10 SASI_Hs01_00149114 predicted 296
11 SASI_Hs01_00149110 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085923 predicted 454
2 SASI_Rn01_00085924 predicted 606
3 SASI_Rn02_00267280 predicted 303
4 SASI_Rn01_00085925 predicted 315
5 SASI_Rn01_00085926 predicted 489
6 SASI_Rn01_00085927 predicted 592
7 SASI_Rn01_00085928 predicted 500
8 SASI_Rn01_00085929 predicted 506
9 SASI_Rn01_00085930 predicted 486
10 SASI_Rn01_00085931 predicted 338
11 SASI_Rn01_00085922 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125478 predicted 746
2 SASI_Rn01_00125479 predicted 546
3 SASI_Rn01_00125480 predicted 87
4 SASI_Rn01_00125481 predicted 607
5 SASI_Rn01_00125482 predicted 488
6 SASI_Rn01_00125483 predicted 595
7 SASI_Rn01_00125484 predicted 107
8 SASI_Rn01_00125485 predicted 509
9 SASI_Rn01_00125486 predicted 744
10 SASI_Rn01_00125487 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091374 predicted 1137
2 SASI_Mm01_00091375 predicted 586
3 SASI_Mm01_00091376 predicted 353
4 SASI_Mm01_00091377 predicted 209
5 SASI_Mm01_00091378 predicted 1023
6 SASI_Mm01_00091379 predicted 343
7 SASI_Mm01_00091380 predicted 612
8 SASI_Mm01_00091381 predicted 684
9 SASI_Mm01_00091382 predicted 743
10 SASI_Mm01_00091383 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014404
CACNG5 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-652s21c1
Sequence:CCGGAGGGACATTCCACAACCATTTCTCGAGAAATGGTTGTGGAATGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-327s21c1
Sequence:CCGGCTTCATGTTCATTGGGTTTATCTCGAGATAAACCCAATGAACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-518s21c1
Sequence:CCGGACAAGTATGGGTGGTCGTTTGCTCGAGCAAACGACCACCCATACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-578s1c1
Sequence:CCGGCCGTCACCCTAAGTATGGATACTCGAGTATCCATACTTAGGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-210s1c1
Sequence:CCGGGCGTTGCTTCACCATAGAATACTCGAGTATTCTATGGTGAAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-450s1c1
Sequence:CCGGGCTCTACATCTCCAGCATCAACTCGAGTTGATGCTGGAGATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-269s1c1
Sequence:CCGGCGGTCAATGTTCTAAAGATGACTCGAGTCATCTTTAGAACATTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-710s1c1
Sequence:CCGGCCCAGAATGTGTCACTGTCTTCTCGAGAAGACAGTGACACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014404
CACNG5 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-652s21c1
Sequence:CCGGAGGGACATTCCACAACCATTTCTCGAGAAATGGTTGTGGAATGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-327s21c1
Sequence:CCGGCTTCATGTTCATTGGGTTTATCTCGAGATAAACCCAATGAACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-518s21c1
Sequence:CCGGACAAGTATGGGTGGTCGTTTGCTCGAGCAAACGACCACCCATACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-578s1c1
Sequence:CCGGCCGTCACCCTAAGTATGGATACTCGAGTATCCATACTTAGGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-210s1c1
Sequence:CCGGGCGTTGCTTCACCATAGAATACTCGAGTATTCTATGGTGAAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-450s1c1
Sequence:CCGGGCTCTACATCTCCAGCATCAACTCGAGTTGATGCTGGAGATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-269s1c1
Sequence:CCGGCGGTCAATGTTCTAAAGATGACTCGAGTCATCTTTAGAACATTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-710s1c1
Sequence:CCGGCCCAGAATGTGTCACTGTCTTCTCGAGAAGACAGTGACACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014404
CACNG5 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-652s21c1
Sequence:CCGGAGGGACATTCCACAACCATTTCTCGAGAAATGGTTGTGGAATGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-327s21c1
Sequence:CCGGCTTCATGTTCATTGGGTTTATCTCGAGATAAACCCAATGAACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014404.1-518s21c1
Sequence:CCGGACAAGTATGGGTGGTCGTTTGCTCGAGCAAACGACCACCCATACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-578s1c1
Sequence:CCGGCCGTCACCCTAAGTATGGATACTCGAGTATCCATACTTAGGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-210s1c1
Sequence:CCGGGCGTTGCTTCACCATAGAATACTCGAGTATTCTATGGTGAAGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-450s1c1
Sequence:CCGGGCTCTACATCTCCAGCATCAACTCGAGTTGATGCTGGAGATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-269s1c1
Sequence:CCGGCGGTCAATGTTCTAAAGATGACTCGAGTCATCTTTAGAACATTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014404.1-710s1c1
Sequence:CCGGCCCAGAATGTGTCACTGTCTTCTCGAGAAGACAGTGACACATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080644
CACNG5 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-608s1c1
Sequence:CCGGGACCTATTTCAACTACAAGTACTCGAGTACTTGTAGTTGAAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-440s1c1
Sequence:CCGGCATTGGGTTTATCCTGAGCAACTCGAGTTGCTCAGGATAAACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-764s1c1
Sequence:CCGGTCTGAGCAACTGCTCCGATTACTCGAGTAATCGGAGCAGTTGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-325s1c1
Sequence:CCGGCCATAGAGTATGTGATGCCCACTCGAGTGGGCATCACATACTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-866s1c1
Sequence:CCGGGAACAGCAACTACCCAGCTTTCTCGAGAAAGCTGGGTAGTTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080644
CACNG5 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-608s1c1
Sequence:CCGGGACCTATTTCAACTACAAGTACTCGAGTACTTGTAGTTGAAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-440s1c1
Sequence:CCGGCATTGGGTTTATCCTGAGCAACTCGAGTTGCTCAGGATAAACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-764s1c1
Sequence:CCGGTCTGAGCAACTGCTCCGATTACTCGAGTAATCGGAGCAGTTGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-325s1c1
Sequence:CCGGCCATAGAGTATGTGATGCCCACTCGAGTGGGCATCACATACTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-866s1c1
Sequence:CCGGGAACAGCAACTACCCAGCTTTCTCGAGAAAGCTGGGTAGTTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080644
CACNG5 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-608s1c1
Sequence:CCGGGACCTATTTCAACTACAAGTACTCGAGTACTTGTAGTTGAAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-440s1c1
Sequence:CCGGCATTGGGTTTATCCTGAGCAACTCGAGTTGCTCAGGATAAACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-764s1c1
Sequence:CCGGTCTGAGCAACTGCTCCGATTACTCGAGTAATCGGAGCAGTTGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-325s1c1
Sequence:CCGGCCATAGAGTATGTGATGCCCACTCGAGTGGGCATCACATACTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080644.2-866s1c1
Sequence:CCGGGAACAGCAACTACCCAGCTTTCTCGAGAAAGCTGGGTAGTTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks