EMAIL THIS PAGE TO A FRIEND

CACNG6

calcium channel, voltage-dependent, gamma subunit 6

UniProtKB ID: Q9BXT2
Gene ID:
Human(59285) Summary: Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
Mouse(54378) calcium channel, voltage-dependent, gamma subunit 6
Rat(140727) calcium channel, voltage-dependent, gamma subunit 6
cow(521616) calcium channel, voltage-dependent, gamma subunit 6
dog(484315) calcium channel, voltage-dependent, gamma subunit 6
domestic cat(101084666) calcium channel, voltage-dependent, gamma subunit 6
domestic guinea pig(100729890) calcium channel, voltage-dependent, gamma subunit 6
naked mole-rat(101722990) calcium channel, voltage-dependent, gamma subunit 6
sheep(101118891) calcium channel, voltage-dependent, gamma subunit 6
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031897 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184801 MISSION® esiRNA esiRNA targeting mouse Cacng6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031897 Rosetta Predictions human pricing
NM_145814 Rosetta Predictions human pricing
NM_145815 Rosetta Predictions human pricing
NM_080694 Rosetta Predictions rat pricing
NM_133183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045292 predicted 1183
2 SASI_Hs01_00045293 predicted 1189
3 SASI_Hs01_00045294 predicted 1160
4 SASI_Hs01_00045295 predicted 1158
5 SASI_Hs01_00045296 predicted 1158
6 SASI_Hs01_00045297 predicted 1154
7 SASI_Hs01_00045298 predicted 1148
8 SASI_Hs02_00359009 predicted 1162
9 SASI_Hs02_00359010 predicted 1144
10 SASI_Hs02_00359011 predicted 1161
11 SASI_Hs01_00045289 predicted 1196
12 SASI_Hs01_00045290 predicted 1199
13 SASI_Hs01_00045291 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122452 predicted 1395
2 SASI_Hs01_00122453 predicted 1404
3 SASI_Hs01_00122454 predicted 1373
4 SASI_Hs01_00122455 predicted 1368
5 SASI_Hs01_00122456 predicted 1370
6 SASI_Hs01_00122457 predicted 1359
7 SASI_Hs02_00365376 predicted 1360
8 SASI_Hs02_00365377 predicted 1378
9 SASI_Hs02_00365378 predicted 1362
10 SASI_Hs02_00365379 predicted 1374
11 SASI_Hs01_00122448 predicted 1403
12 SASI_Hs01_00122449 predicted 1411
13 SASI_Hs01_00122450 predicted 1410
14 SASI_Hs01_00122451 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169567 predicted 1263
2 SASI_Hs01_00169568 predicted 1258
3 SASI_Hs01_00169569 predicted 1237
4 SASI_Hs01_00169570 predicted 1231
5 SASI_Hs01_00169571 predicted 1227
6 SASI_Hs01_00169572 predicted 1228
7 SASI_Hs02_00365380 predicted 1223
8 SASI_Hs02_00365381 predicted 1235
9 SASI_Hs02_00365382 predicted 1220
10 SASI_Hs02_00365383 predicted 1236
11 SASI_Hs01_00169563 predicted 1268
12 SASI_Hs01_00169564 predicted 1269
13 SASI_Hs01_00169565 predicted 1274
14 SASI_Hs01_00169566 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077910 predicted 483
2 SASI_Rn02_00267281 predicted 472
3 SASI_Rn01_00077911 predicted 334
4 SASI_Rn01_00077912 predicted 306
5 SASI_Rn02_00267282 predicted 536
6 SASI_Rn01_00077914 predicted 404
7 SASI_Rn01_00077915 predicted 510
8 SASI_Rn01_00077916 predicted 391
9 SASI_Rn01_00077917 predicted 499
10 SASI_Rn01_00077918 predicted 389
11 SASI_Rn01_00077913 predicted 380
12 SASI_Rn01_00077919 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127372 predicted 469
2 SASI_Mm01_00127373 predicted 331
3 SASI_Mm01_00127374 predicted 372
4 SASI_Mm01_00127375 predicted 373
5 SASI_Mm01_00127376 predicted 506
6 SASI_Mm01_00127377 predicted 379
7 SASI_Mm01_00127378 predicted 390
8 SASI_Mm01_00127379 predicted 222
9 SASI_Mm01_00127380 predicted 323
10 SASI_Mm01_00127381 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133183
CACNG6 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-339s1c1
Sequence:CCGGCTGCACCTACTTCAAATTCTTCTCGAGAAGAATTTGAAGTAGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-193s1c1
Sequence:CCGGCTCAATACATACAAGACCAATCTCGAGATTGGTCTTGTATGTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-330s1c1
Sequence:CCGGAGAAGCAAACTGCACCTACTTCTCGAGAAGTAGGTGCAGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-472s1c1
Sequence:CCGGTGTGTCATCATGGTGCTCAGTCTCGAGACTGAGCACCATGATGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-182s1c1
Sequence:CCGGTCTGGGTGGAACTCAATACATCTCGAGATGTATTGAGTTCCACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133183
CACNG6 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-339s1c1
Sequence:CCGGCTGCACCTACTTCAAATTCTTCTCGAGAAGAATTTGAAGTAGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-193s1c1
Sequence:CCGGCTCAATACATACAAGACCAATCTCGAGATTGGTCTTGTATGTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-330s1c1
Sequence:CCGGAGAAGCAAACTGCACCTACTTCTCGAGAAGTAGGTGCAGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-472s1c1
Sequence:CCGGTGTGTCATCATGGTGCTCAGTCTCGAGACTGAGCACCATGATGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-182s1c1
Sequence:CCGGTCTGGGTGGAACTCAATACATCTCGAGATGTATTGAGTTCCACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133183
CACNG6 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-339s1c1
Sequence:CCGGCTGCACCTACTTCAAATTCTTCTCGAGAAGAATTTGAAGTAGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-193s1c1
Sequence:CCGGCTCAATACATACAAGACCAATCTCGAGATTGGTCTTGTATGTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-330s1c1
Sequence:CCGGAGAAGCAAACTGCACCTACTTCTCGAGAAGTAGGTGCAGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-472s1c1
Sequence:CCGGTGTGTCATCATGGTGCTCAGTCTCGAGACTGAGCACCATGATGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133183.1-182s1c1
Sequence:CCGGTCTGGGTGGAACTCAATACATCTCGAGATGTATTGAGTTCCACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031897
CACNG6 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-1007s1c1
Sequence:CCGGCCCACGCCTCACCTACGAGTACTCGAGTACTCGTAGGTGAGGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-836s1c1
Sequence:CCGGGCTGTGGAAGGCGTGCACCAACTCGAGTTGGTGCACGCCTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-956s1c1
Sequence:CCGGGCATTCCGTGAGGGCCCTGCTCTCGAGAGCAGGGCCCTCACGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-701s1c1
Sequence:CCGGGAAGGTGAAGCTGGCGCTGCTCTCGAGAGCAGCGCCAGCTTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-1093s1c1
Sequence:CCGGTGCTGCTCACACTGCCTTCCTCTCGAGAGGAAGGCAGTGTGAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031897.2-1198s21c1
Sequence:CCGGCTTTGACCTTCTCCATTGTACCTCGAGGTACAATGGAGAAGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031897.2-776s21c1
Sequence:CCGGGGTGGAGCTCAACACCTACAACTCGAGTTGTAGGTGTTGAGCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031897
CACNG6 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-1007s1c1
Sequence:CCGGCCCACGCCTCACCTACGAGTACTCGAGTACTCGTAGGTGAGGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-836s1c1
Sequence:CCGGGCTGTGGAAGGCGTGCACCAACTCGAGTTGGTGCACGCCTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-956s1c1
Sequence:CCGGGCATTCCGTGAGGGCCCTGCTCTCGAGAGCAGGGCCCTCACGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-701s1c1
Sequence:CCGGGAAGGTGAAGCTGGCGCTGCTCTCGAGAGCAGCGCCAGCTTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-1093s1c1
Sequence:CCGGTGCTGCTCACACTGCCTTCCTCTCGAGAGGAAGGCAGTGTGAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031897.2-1198s21c1
Sequence:CCGGCTTTGACCTTCTCCATTGTACCTCGAGGTACAATGGAGAAGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031897.2-776s21c1
Sequence:CCGGGGTGGAGCTCAACACCTACAACTCGAGTTGTAGGTGTTGAGCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031897
CACNG6 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-1007s1c1
Sequence:CCGGCCCACGCCTCACCTACGAGTACTCGAGTACTCGTAGGTGAGGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-836s1c1
Sequence:CCGGGCTGTGGAAGGCGTGCACCAACTCGAGTTGGTGCACGCCTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-956s1c1
Sequence:CCGGGCATTCCGTGAGGGCCCTGCTCTCGAGAGCAGGGCCCTCACGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-701s1c1
Sequence:CCGGGAAGGTGAAGCTGGCGCTGCTCTCGAGAGCAGCGCCAGCTTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031897.2-1093s1c1
Sequence:CCGGTGCTGCTCACACTGCCTTCCTCTCGAGAGGAAGGCAGTGTGAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031897.2-1198s21c1
Sequence:CCGGCTTTGACCTTCTCCATTGTACCTCGAGGTACAATGGAGAAGGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031897.2-776s21c1
Sequence:CCGGGGTGGAGCTCAACACCTACAACTCGAGTTGTAGGTGTTGAGCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks