EMAIL THIS PAGE TO A FRIEND

CACNG7

calcium channel, voltage-dependent, gamma subunit 7

56 Gene Product Result for
UniProtKB ID: P62955, Q52LL8, Q8VBX3, Q8WXS6, Q9BXT1
Gene ID:
Human(59284) Summary: The protein encoded by this gene is a type II transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type I TARP and a calcium channel gamma subunit. [provided by RefSeq, Dec 2010]
Mouse(81904) calcium channel, voltage-dependent, gamma subunit 7
Rat(140728) calcium channel, voltage-dependent, gamma subunit 7
chicken(417429) calcium channel, voltage-dependent, gamma subunit 7
domestic cat(101081939) calcium channel, voltage-dependent, gamma subunit 7
cow(539969) calcium channel, voltage-dependent, gamma subunit 7
dog(611509) calcium channel, voltage-dependent, gamma subunit 7
sheep(101116675) calcium channel, voltage-dependent, gamma subunit 7
Domestic Rabbit(100328774) calcium channel, voltage-dependent, gamma subunit 7
naked mole-rat(101697969) calcium channel, voltage-dependent, gamma subunit 7
domestic guinea pig(100734510) calcium channel, voltage-dependent, gamma subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031896 Rosetta Predictions human pricing
NM_080695 Rosetta Predictions rat pricing
NM_133189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207524 predicted 999
2 SASI_Hs01_00207525 predicted 758
3 SASI_Hs02_00359008 predicted 284
4 SASI_Hs01_00207526 predicted 342
5 SASI_Hs01_00207527 predicted 476
6 SASI_Hs01_00207528 predicted 370
7 SASI_Hs01_00207529 predicted 1056
8 SASI_Hs01_00207530 predicted 654
9 SASI_Hs01_00207531 predicted 1272
10 SASI_Hs01_00207532 predicted 584
11 SASI_Hs01_00207533 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049856 predicted 571
2 SASI_Rn01_00049857 predicted 576
3 SASI_Rn01_00049858 predicted 571
4 SASI_Rn01_00049859 predicted 578
5 SASI_Rn01_00049860 predicted 378
6 SASI_Rn01_00049861 predicted 490
7 SASI_Rn01_00049862 predicted 388
8 SASI_Rn01_00049863 predicted 324
9 SASI_Rn01_00049865 predicted 360
10 SASI_Rn02_00267283 predicted 494
11 SASI_Rn01_00049864 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111866 predicted 574
2 SASI_Mm02_00338369 predicted 490
3 SASI_Mm01_00111869 predicted 455
4 SASI_Mm02_00338370 predicted 584
5 SASI_Mm01_00111870 predicted 577
6 SASI_Mm01_00111871 predicted 573
7 SASI_Mm01_00111872 predicted 376
8 SASI_Mm02_00338371 predicted 208
9 SASI_Mm02_00338372 predicted 307
10 SASI_Mm02_00338373 predicted 363
11 SASI_Mm01_00111864 predicted 1255
12 SASI_Mm01_00111865 predicted 1104
13 SASI_Mm01_00111867 predicted 783
14 SASI_Mm01_00111868 predicted 205
15 SASI_Mm01_00111873 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133189
CACNG7 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-466s21c1
Sequence:CCGGATCAACGACGAGGTCATGAACCTCGAGGTTCATGACCTCGTCGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-494s21c1
Sequence:CCGGGCAGCTCTGAGCAGTACTTTCCTCGAGGAAAGTACTGCTCAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-439s21c1
Sequence:CCGCGTGGGCTTGGTCCTATACATCCTCGAGGATGTATAGGACCAAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-517s21c1
Sequence:CCGGTATCGCTACGGGTGGTCCTTTCTCGAGAAAGGACCACCCGTAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-390s1c1
Sequence:CCGGTGCGTTCGTTTCTGGCATCTTCTCGAGAAGATGCCAGAAACGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-220s1c1
Sequence:CCGGGCTTCTGAGTACTTTCTTGAACTCGAGTTCAAGAAAGTACTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-244s1c1
Sequence:CCGGGAGATCAACTTGGTGACGGAACTCGAGTTCCGTCACCAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-339s1c1
Sequence:CCGGCGCCTTTGTCATCAGCAACATCTCGAGATGTTGCTGATGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-172s1c1
Sequence:CCGGCTCTGGAGAGTCTGCTTCTTTCTCGAGAAAGAAGCAGACTCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133189
CACNG7 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-466s21c1
Sequence:CCGGATCAACGACGAGGTCATGAACCTCGAGGTTCATGACCTCGTCGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-494s21c1
Sequence:CCGGGCAGCTCTGAGCAGTACTTTCCTCGAGGAAAGTACTGCTCAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-439s21c1
Sequence:CCGCGTGGGCTTGGTCCTATACATCCTCGAGGATGTATAGGACCAAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-517s21c1
Sequence:CCGGTATCGCTACGGGTGGTCCTTTCTCGAGAAAGGACCACCCGTAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-390s1c1
Sequence:CCGGTGCGTTCGTTTCTGGCATCTTCTCGAGAAGATGCCAGAAACGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-220s1c1
Sequence:CCGGGCTTCTGAGTACTTTCTTGAACTCGAGTTCAAGAAAGTACTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-244s1c1
Sequence:CCGGGAGATCAACTTGGTGACGGAACTCGAGTTCCGTCACCAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-339s1c1
Sequence:CCGGCGCCTTTGTCATCAGCAACATCTCGAGATGTTGCTGATGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-172s1c1
Sequence:CCGGCTCTGGAGAGTCTGCTTCTTTCTCGAGAAAGAAGCAGACTCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133189
CACNG7 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-466s21c1
Sequence:CCGGATCAACGACGAGGTCATGAACCTCGAGGTTCATGACCTCGTCGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-494s21c1
Sequence:CCGGGCAGCTCTGAGCAGTACTTTCCTCGAGGAAAGTACTGCTCAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-439s21c1
Sequence:CCGCGTGGGCTTGGTCCTATACATCCTCGAGGATGTATAGGACCAAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133189.3-517s21c1
Sequence:CCGGTATCGCTACGGGTGGTCCTTTCTCGAGAAAGGACCACCCGTAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-390s1c1
Sequence:CCGGTGCGTTCGTTTCTGGCATCTTCTCGAGAAGATGCCAGAAACGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-220s1c1
Sequence:CCGGGCTTCTGAGTACTTTCTTGAACTCGAGTTCAAGAAAGTACTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-244s1c1
Sequence:CCGGGAGATCAACTTGGTGACGGAACTCGAGTTCCGTCACCAAGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-339s1c1
Sequence:CCGGCGCCTTTGTCATCAGCAACATCTCGAGATGTTGCTGATGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133189.1-172s1c1
Sequence:CCGGCTCTGGAGAGTCTGCTTCTTTCTCGAGAAAGAAGCAGACTCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031896
CACNG7 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031896.3-531s21c1
Sequence:CCGGTTATCGCTACGGGTGGTCTTTCTCGAGAAAGACCACCCGTAGCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031896.3-228s21c1
Sequence:CCGCCTGTGTGGCCTCAGAATATTTCTCGAGAAATATTCTGAGGCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-768s1c1
Sequence:CCGGCATCCAAATGACGCAGAACTACTCGAGTAGTTCTGCGTCATTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-259s1c1
Sequence:CCGGGAGATCAATTTGGTGACGGAACTCGAGTTCCGTCACCAAATTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-415s1c1
Sequence:CCGGTCTGGCATCTTCTTCATACTACTCGAGTAGTATGAAGAAGATGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-562s1c1
Sequence:CCGGGCTTCCTCCTTCCTACTCAAACTCGAGTTTGAGTAGGAAGGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-363s1c1
Sequence:CCGGCATCAGCAACATCGGCCACATCTCGAGATGTGGCCGATGTTGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031896
CACNG7 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031896.3-531s21c1
Sequence:CCGGTTATCGCTACGGGTGGTCTTTCTCGAGAAAGACCACCCGTAGCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031896.3-228s21c1
Sequence:CCGCCTGTGTGGCCTCAGAATATTTCTCGAGAAATATTCTGAGGCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-768s1c1
Sequence:CCGGCATCCAAATGACGCAGAACTACTCGAGTAGTTCTGCGTCATTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-259s1c1
Sequence:CCGGGAGATCAATTTGGTGACGGAACTCGAGTTCCGTCACCAAATTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-415s1c1
Sequence:CCGGTCTGGCATCTTCTTCATACTACTCGAGTAGTATGAAGAAGATGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-562s1c1
Sequence:CCGGGCTTCCTCCTTCCTACTCAAACTCGAGTTTGAGTAGGAAGGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-363s1c1
Sequence:CCGGCATCAGCAACATCGGCCACATCTCGAGATGTGGCCGATGTTGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031896
CACNG7 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031896.3-531s21c1
Sequence:CCGGTTATCGCTACGGGTGGTCTTTCTCGAGAAAGACCACCCGTAGCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031896.3-228s21c1
Sequence:CCGCCTGTGTGGCCTCAGAATATTTCTCGAGAAATATTCTGAGGCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-768s1c1
Sequence:CCGGCATCCAAATGACGCAGAACTACTCGAGTAGTTCTGCGTCATTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-259s1c1
Sequence:CCGGGAGATCAATTTGGTGACGGAACTCGAGTTCCGTCACCAAATTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-415s1c1
Sequence:CCGGTCTGGCATCTTCTTCATACTACTCGAGTAGTATGAAGAAGATGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-562s1c1
Sequence:CCGGGCTTCCTCCTTCCTACTCAAACTCGAGTTTGAGTAGGAAGGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031896.3-363s1c1
Sequence:CCGGCATCAGCAACATCGGCCACATCTCGAGATGTGGCCGATGTTGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks