EMAIL THIS PAGE TO A FRIEND

CACNG8

calcium channel, voltage-dependent, gamma subunit 8

52 Gene Product Result for
UniProtKB ID: Q8WXS5, Q9BXT0, Q9BY23
Gene ID:
Human(59283) Summary: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type II TARP and a calcium channel gamma subunit. The mRNA for this gene is believed to initiate translation from a non-AUG (CUG) start codon. [provided by RefSeq, Dec 2010]
Mouse(81905) calcium channel, voltage-dependent, gamma subunit 8
Rat(140729) calcium channel, voltage-dependent, gamma subunit 8
domestic cat(101084919) calcium channel, voltage-dependent, gamma subunit 8
cow(618518) calcium channel, voltage-dependent, gamma subunit 8
dog(611498) calcium channel, voltage-dependent, gamma subunit 8
naked mole-rat(101723340) calcium channel, voltage-dependent, gamma subunit 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031895 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031895 Rosetta Predictions human pricing
NM_080696 Rosetta Predictions rat pricing
NM_133190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245931 predicted 446
2 SASI_Hs01_00245932 predicted 373
3 SASI_Hs02_00359004 predicted 446
4 SASI_Hs01_00245933 predicted 549
5 SASI_Hs01_00245934 predicted 403
6 SASI_Hs02_00359005 predicted 399
7 SASI_Hs02_00359006 predicted 401
8 SASI_Hs02_00359007 predicted 453
9 SASI_Hs01_00245938 predicted 447
10 SASI_Hs01_00245939 predicted 468
11 SASI_Hs01_00245930 predicted 399
12 SASI_Hs01_00245935 predicted 312
13 SASI_Hs01_00245936 predicted 346
14 SASI_Hs01_00245937 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064972 predicted 341
2 SASI_Rn01_00064973 predicted 785
3 SASI_Rn01_00064974 predicted 292
4 SASI_Rn01_00064975 predicted 649
5 SASI_Rn01_00064977 predicted 341
6 SASI_Rn01_00064978 predicted 657
7 SASI_Rn01_00064979 predicted 244
8 SASI_Rn01_00064980 predicted 259
9 SASI_Rn02_00267284 predicted 700
10 SASI_Rn01_00064981 predicted 598
11 SASI_Rn01_00064976 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122806 predicted 763
2 SASI_Mm01_00122807 predicted 399
3 SASI_Mm01_00122808 predicted 454
4 SASI_Mm01_00122809 predicted 757
5 SASI_Mm01_00122810 predicted 352
6 SASI_Mm01_00122811 predicted 448
7 SASI_Mm01_00122812 predicted 762
8 SASI_Mm01_00122813 predicted 808
9 SASI_Mm01_00122814 predicted 464
10 SASI_Mm02_00338374 predicted 763
11 SASI_Mm01_00122805 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133190
CACNG8 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-240s1c1
Sequence:CCGGGCTCTACACAAGAGCTCTCATCTCGAGATGAGAGCTCTTGTGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-405s1c1
Sequence:CCGGCTGCGTGAAGATCAACCACTTCTCGAGAAGTGGTTGATCTTCACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-609s1c1
Sequence:CCGGAGCAGGCTTGAGCAACATCATCTCGAGATGATGTTGCTCAAGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-768s1c1
Sequence:CCGGACTGGCCGTCAACATCTACATCTCGAGATGTAGATGTTGACGGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-165s1c1
Sequence:CCGGTCAGGTACTACTGACCACCATCTCGAGATGGTGGTCAGTAGTACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133190
CACNG8 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-240s1c1
Sequence:CCGGGCTCTACACAAGAGCTCTCATCTCGAGATGAGAGCTCTTGTGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-405s1c1
Sequence:CCGGCTGCGTGAAGATCAACCACTTCTCGAGAAGTGGTTGATCTTCACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-609s1c1
Sequence:CCGGAGCAGGCTTGAGCAACATCATCTCGAGATGATGTTGCTCAAGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-768s1c1
Sequence:CCGGACTGGCCGTCAACATCTACATCTCGAGATGTAGATGTTGACGGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-165s1c1
Sequence:CCGGTCAGGTACTACTGACCACCATCTCGAGATGGTGGTCAGTAGTACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133190
CACNG8 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-240s1c1
Sequence:CCGGGCTCTACACAAGAGCTCTCATCTCGAGATGAGAGCTCTTGTGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-405s1c1
Sequence:CCGGCTGCGTGAAGATCAACCACTTCTCGAGAAGTGGTTGATCTTCACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-609s1c1
Sequence:CCGGAGCAGGCTTGAGCAACATCATCTCGAGATGATGTTGCTCAAGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-768s1c1
Sequence:CCGGACTGGCCGTCAACATCTACATCTCGAGATGTAGATGTTGACGGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133190.1-165s1c1
Sequence:CCGGTCAGGTACTACTGACCACCATCTCGAGATGGTGGTCAGTAGTACCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031895
CACNG8 MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, gamma subunit 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-455s1c1
Sequence:CCGGGCGGAGTATCTACTCCGAGTTCTCGAGAACTCGGAGTAGATACTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-403s1c1
Sequence:CCGGCTGCGTGAAGATCAATCATTTCTCGAGAAATGATTGATCTTCACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-1192s1c1
Sequence:CCGGCGGCTTCCTCACGCTGCACAACTCGAGTTGTGCAGCGTGAGGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-616s1c1
Sequence:CCGGGAGCAACATCATCGGCGTGATCTCGAGATCACGCCGATGATGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-556s1c1
Sequence:CCGGCTACAAGTCCAAGAGGAACATCTCGAGATGTTCCTCTTGGACTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031895.4-206s21c1
Sequence:CCGGATGACCATCGCCATCAGCACTCTCGAGAGTGCTGATGGCGATGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031895.4-998s21c1
Sequence:CCGCTTTGCCTCCACGGACATCTCCCTCGAGGGAGATGTCCGTGGAGGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031895
CACNG8 MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, gamma subunit 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-455s1c1
Sequence:CCGGGCGGAGTATCTACTCCGAGTTCTCGAGAACTCGGAGTAGATACTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-403s1c1
Sequence:CCGGCTGCGTGAAGATCAATCATTTCTCGAGAAATGATTGATCTTCACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-1192s1c1
Sequence:CCGGCGGCTTCCTCACGCTGCACAACTCGAGTTGTGCAGCGTGAGGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-616s1c1
Sequence:CCGGGAGCAACATCATCGGCGTGATCTCGAGATCACGCCGATGATGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-556s1c1
Sequence:CCGGCTACAAGTCCAAGAGGAACATCTCGAGATGTTCCTCTTGGACTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031895.4-206s21c1
Sequence:CCGGATGACCATCGCCATCAGCACTCTCGAGAGTGCTGATGGCGATGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031895.4-998s21c1
Sequence:CCGCTTTGCCTCCACGGACATCTCCCTCGAGGGAGATGTCCGTGGAGGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031895
CACNG8 MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, gamma subunit 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-455s1c1
Sequence:CCGGGCGGAGTATCTACTCCGAGTTCTCGAGAACTCGGAGTAGATACTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-403s1c1
Sequence:CCGGCTGCGTGAAGATCAATCATTTCTCGAGAAATGATTGATCTTCACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-1192s1c1
Sequence:CCGGCGGCTTCCTCACGCTGCACAACTCGAGTTGTGCAGCGTGAGGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-616s1c1
Sequence:CCGGGAGCAACATCATCGGCGTGATCTCGAGATCACGCCGATGATGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031895.4-556s1c1
Sequence:CCGGCTACAAGTCCAAGAGGAACATCTCGAGATGTTCCTCTTGGACTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031895.4-206s21c1
Sequence:CCGGATGACCATCGCCATCAGCACTCTCGAGAGTGCTGATGGCGATGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031895.4-998s21c1
Sequence:CCGCTTTGCCTCCACGGACATCTCCCTCGAGGGAGATGTCCGTGGAGGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)