EMAIL THIS PAGE TO A FRIEND

CACTIN

cactin, spliceosome C complex subunit

144 Gene Product Result for
Synonyms: C19orf29 NY-REN-24 fSAPc
Gene ID:
Mouse(70312) cactin, spliceosome C complex subunit
Rat(500790) cactin, spliceosome C complex subunit
chicken(420073) cactin, spliceosome C complex subunit
dog(485055) cactin, spliceosome C complex subunit
cow(528952) cactin, spliceosome C complex subunit
domestic cat(101089333) cactin, spliceosome C complex subunit
fruit fly(33043) CG1676 gene product from transcript CG1676-RA
naked mole-rat(101700267) cactin, spliceosome C complex subunit
domestic guinea pig(100715073) cactin, spliceosome C complex subunit
sheep(101115790) cactin, spliceosome C complex subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080543 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080543 Rosetta Predictions human pricing
NM_021231 Rosetta Predictions human pricing
XM_928631 Rosetta Predictions human pricing
XM_933009 Rosetta Predictions human pricing
XM_933013 Rosetta Predictions human pricing
XM_933019 Rosetta Predictions human pricing
XM_933023 Rosetta Predictions human pricing
NM_001081447 Rosetta Predictions rat pricing
XM_576177 Rosetta Predictions rat pricing
XR_009036 Rosetta Predictions rat pricing
NM_027381 Rosetta Predictions mouse pricing
XM_618787 Rosetta Predictions mouse pricing
XM_901292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315848 predicted 2031
2 SASI_Hs02_00315849 predicted 217
3 SASI_Hs02_00315850 predicted 1132
4 SASI_Hs02_00315851 predicted 813
5 SASI_Hs02_00315852 predicted 1240
6 SASI_Hs02_00315853 predicted 1926
7 SASI_Hs02_00315854 predicted 287
8 SASI_Hs02_00315855 predicted 305
9 SASI_Hs02_00315856 predicted 611
10 SASI_Hs02_00315857 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354856 predicted 2030
2 SASI_Hs02_00354857 predicted 215
3 SASI_Hs02_00354858 predicted 1127
4 SASI_Hs02_00354859 predicted 814
5 SASI_Hs02_00354860 predicted 1241
6 SASI_Hs02_00354861 predicted 1927
7 SASI_Hs02_00354862 predicted 292
8 SASI_Hs02_00354863 predicted 306
9 SASI_Hs02_00354864 predicted 619
10 SASI_Hs02_00354865 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299229 predicted 2189
2 SASI_Hs01_00299230 predicted 2280
3 SASI_Hs01_00299231 predicted 2288
4 SASI_Hs01_00299232 predicted 2194
5 SASI_Hs01_00299233 predicted 1131
6 SASI_Hs01_00299234 predicted 815
7 SASI_Hs01_00299235 predicted 1238
8 SASI_Hs01_00299236 predicted 1929
9 SASI_Hs01_00299237 predicted 284
10 SASI_Hs01_00299238 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281020 predicted 2187
2 SASI_Hs01_00281021 predicted 2271
3 SASI_Hs01_00281022 predicted 2293
4 SASI_Hs01_00281023 predicted 2199
5 SASI_Hs01_00281024 predicted 1124
6 SASI_Hs01_00281025 predicted 813
7 SASI_Hs01_00281026 predicted 1240
8 SASI_Hs01_00281027 predicted 1929
9 SASI_Hs01_00281028 predicted 289
10 SASI_Hs01_00281029 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276704 predicted 2190
2 SASI_Hs01_00276705 predicted 2193
3 SASI_Hs01_00276706 predicted 1123
4 SASI_Hs01_00276707 predicted 811
5 SASI_Hs01_00276708 predicted 1247
6 SASI_Hs01_00276709 predicted 1925
7 SASI_Hs01_00276710 predicted 285
8 SASI_Hs01_00276711 predicted 611
9 SASI_Hs01_00276712 predicted 2763
10 SASI_Hs01_00276713 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265167 predicted 2189
2 SASI_Hs01_00265168 predicted 2200
3 SASI_Hs01_00265169 predicted 1124
4 SASI_Hs01_00265170 predicted 819
5 SASI_Hs01_00265171 predicted 1248
6 SASI_Hs01_00265172 predicted 1926
7 SASI_Hs01_00265173 predicted 291
8 SASI_Hs01_00265174 predicted 619
9 SASI_Hs01_00265175 predicted 2756
10 SASI_Hs01_00265176 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273265 predicted 936
2 SASI_Hs01_00273266 predicted 1090
3 SASI_Hs01_00273267 predicted 972
4 SASI_Hs01_00273268 predicted 1104
5 SASI_Hs01_00273269 predicted 831
6 SASI_Hs01_00273270 predicted 1662
7 SASI_Hs01_00273271 predicted 872
8 SASI_Hs01_00273272 predicted 781
9 SASI_Hs01_00273273 predicted 964
10 SASI_Hs01_00273274 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208599 predicted 1435
2 SASI_Rn02_00208600 predicted 2026
3 SASI_Rn02_00208601 predicted 686
4 SASI_Rn02_00208602 predicted 2001
5 SASI_Rn02_00208603 predicted 2121
6 SASI_Rn02_00208604 predicted 687
7 SASI_Rn02_00208605 predicted 738
8 SASI_Rn02_00208606 predicted 987
9 SASI_Rn02_00208607 predicted 1869
10 SASI_Rn02_00208608 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135645 predicted 1431
2 SASI_Rn01_00135646 predicted 2026
3 SASI_Rn01_00135647 predicted 684
4 SASI_Rn01_00135648 predicted 1993
5 SASI_Rn01_00135649 predicted 2121
6 SASI_Rn01_00135650 predicted 682
7 SASI_Rn01_00135651 predicted 745
8 SASI_Rn01_00135652 predicted 985
9 SASI_Rn01_00135653 predicted 1985
10 SASI_Rn01_00135654 predicted 2180
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152753 predicted 1430
2 SASI_Rn01_00152754 predicted 2034
3 SASI_Rn01_00152755 predicted 685
4 SASI_Rn01_00152756 predicted 2013
5 SASI_Rn01_00152757 predicted 2133
6 SASI_Rn01_00152758 predicted 687
7 SASI_Rn01_00152759 predicted 746
8 SASI_Rn01_00152760 predicted 978
9 SASI_Rn01_00152761 predicted 2000
10 SASI_Rn01_00152762 predicted 2184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332085 predicted 1286
2 SASI_Mm02_00332086 predicted 1939
3 SASI_Mm02_00332087 predicted 539
4 SASI_Mm02_00332088 predicted 831
5 SASI_Mm02_00332089 predicted 984
6 SASI_Mm02_00332090 predicted 1830
7 SASI_Mm02_00332091 predicted 1269
8 SASI_Mm02_00332092 predicted 1456
9 SASI_Mm02_00332093 predicted 1185
10 SASI_Mm02_00332094 predicted 2218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_618787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281676 predicted 1295
2 SASI_Mm01_00281677 predicted 1946
3 SASI_Mm01_00281678 predicted 541
4 SASI_Mm01_00281679 predicted 2199
5 SASI_Mm01_00281680 predicted 892
6 SASI_Mm01_00281681 predicted 837
7 SASI_Mm01_00281682 predicted 994
8 SASI_Mm01_00281683 predicted 1839
9 SASI_Mm01_00281684 predicted 1278
10 SASI_Mm01_00281685 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236095 predicted 443
2 SASI_Mm01_00236096 predicted 1103
3 SASI_Mm01_00236097 predicted 1350
4 SASI_Mm01_00236098 predicted 993
5 SASI_Mm01_00236099 predicted 435
6 SASI_Mm01_00236100 predicted 1096
7 SASI_Mm01_00236101 predicted 623
8 SASI_Mm01_00236102 predicted 345
9 SASI_Mm01_00236103 predicted 1002
10 SASI_Mm01_00236104 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080543
VALIDATED
CACTIN MISSION shRNA Bacterial Glycerol Stock
cactin, spliceosome C complex subunit
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080543.1-1029s21c1
Sequence:CCGGATGCATGAGCCCTACACGTTCCTCGAGGAACGTGTAGGGCTCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-1089s21c1
Sequence:CCGGGAGGATATCCAGGTCTACATGCTCGAGCATGTAGACCTGGATATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-736s21c1
Sequence:CCGGAGCTGAAGGAGCGGAACAAGACTCGAGTCTTGTTCCGCTCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-674s21c1
Sequence:CCGGGGGCACCTTCATCTGGAATAACTCGAGTTATTCCAGATGAAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080543
VALIDATED
CACTIN MISSION shRNA shRNA Plasmid DNA
cactin, spliceosome C complex subunit
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080543.1-1029s21c1
Sequence:CCGGATGCATGAGCCCTACACGTTCCTCGAGGAACGTGTAGGGCTCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-1089s21c1
Sequence:CCGGGAGGATATCCAGGTCTACATGCTCGAGCATGTAGACCTGGATATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-736s21c1
Sequence:CCGGAGCTGAAGGAGCGGAACAAGACTCGAGTCTTGTTCCGCTCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-674s21c1
Sequence:CCGGGGGCACCTTCATCTGGAATAACTCGAGTTATTCCAGATGAAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080543
VALIDATED
CACTIN MISSION shRNA Lentiviral Transduction Particles
cactin, spliceosome C complex subunit
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080543.1-1029s21c1
Sequence:CCGGATGCATGAGCCCTACACGTTCCTCGAGGAACGTGTAGGGCTCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-1089s21c1
Sequence:CCGGGAGGATATCCAGGTCTACATGCTCGAGCATGTAGACCTGGATATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-736s21c1
Sequence:CCGGAGCTGAAGGAGCGGAACAAGACTCGAGTCTTGTTCCGCTCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080543.1-674s21c1
Sequence:CCGGGGGCACCTTCATCTGGAATAACTCGAGTTATTCCAGATGAAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027381
VALIDATED
CACTIN MISSION shRNA Bacterial Glycerol Stock
cactin, spliceosome C complex subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027381.1-1370s21c1
Sequence:CCGGCAACCTGGACATGGGCTATTGCTCGAGCAATAGCCCATGTCCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2228s21c1
Sequence:CCGGCAGTCGTGAGTGGGAGTATTCCTCGAGGAATACTCCCACTCACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027381.1-2012s21c1
Sequence:CCGGCTTCGAGTGGAACAAATATAACTCGAGTTATATTTGTTCCACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2412s21c1
Sequence:CCGGTCCTTCAGAAGCCGTAGGAATCTCGAGATTCCTACGGCTTCTGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2068s21c1
Sequence:CCGGAGATTGTGCAGGGCTACAAATCTCGAGATTTGTAGCCCTGCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027381
VALIDATED
CACTIN MISSION shRNA shRNA Plasmid DNA
cactin, spliceosome C complex subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027381.1-1370s21c1
Sequence:CCGGCAACCTGGACATGGGCTATTGCTCGAGCAATAGCCCATGTCCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2228s21c1
Sequence:CCGGCAGTCGTGAGTGGGAGTATTCCTCGAGGAATACTCCCACTCACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027381.1-2012s21c1
Sequence:CCGGCTTCGAGTGGAACAAATATAACTCGAGTTATATTTGTTCCACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2412s21c1
Sequence:CCGGTCCTTCAGAAGCCGTAGGAATCTCGAGATTCCTACGGCTTCTGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2068s21c1
Sequence:CCGGAGATTGTGCAGGGCTACAAATCTCGAGATTTGTAGCCCTGCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027381
VALIDATED
CACTIN MISSION shRNA Lentiviral Transduction Particles
cactin, spliceosome C complex subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027381.1-1370s21c1
Sequence:CCGGCAACCTGGACATGGGCTATTGCTCGAGCAATAGCCCATGTCCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2228s21c1
Sequence:CCGGCAGTCGTGAGTGGGAGTATTCCTCGAGGAATACTCCCACTCACGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027381.1-2012s21c1
Sequence:CCGGCTTCGAGTGGAACAAATATAACTCGAGTTATATTTGTTCCACTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2412s21c1
Sequence:CCGGTCCTTCAGAAGCCGTAGGAATCTCGAGATTCCTACGGCTTCTGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027381.1-2068s21c1
Sequence:CCGGAGATTGTGCAGGGCTACAAATCTCGAGATTTGTAGCCCTGCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks