EMAIL THIS PAGE TO A FRIEND

CACUL1

CDK2-associated, cullin domain 1

187 Gene Product Result for
Synonyms: C10orf46 CAC1
UniProtKB ID: Q86Y37, Q5XPL7, Q8IY11, Q8N7S4
Gene ID:
Mouse(78832) CDK2 associated, cullin domain 1
Rat(365493) CDK2-associated, cullin domain 1
cow(100337346) CDK2-associated, cullin domain 1
domestic cat(101087944) CDK2-associated, cullin domain 1
dog(477836) CDK2-associated, cullin domain 1
sheep(101105965) CDK2-associated, cullin domain 1
domestic guinea pig(100719746) CDK2-associated, cullin domain 1
naked mole-rat(101721897) CDK2-associated, cullin domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400806 Anti-C10orf46 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB2103745 Anti-C10ORF46 antibody produced in rabbit affinity isolated antibody rat, human, horse, canine, mouse, guinea pig, rabbit,
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153810 Rosetta Predictions human pricing
NM_001014248 Rosetta Predictions rat pricing
NM_030197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087778 predicted 1009
2 SASI_Hs01_00087779 predicted 1194
3 SASI_Hs01_00087781 predicted 1370
4 SASI_Hs01_00087782 predicted 967
5 SASI_Hs01_00087783 predicted 1267
6 SASI_Hs01_00087786 predicted 1483
7 SASI_Hs02_00367484 predicted 1258
8 SASI_Hs02_00367485 predicted 950
9 SASI_Hs02_00367486 predicted 516
10 SASI_Hs02_00367487 predicted 521
11 SASI_Hs01_00087780 predicted 1092
12 SASI_Hs01_00087784 predicted 1336
13 SASI_Hs01_00087785 predicted 1467
14 SASI_Hs01_00087787 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032611 predicted 638
2 SASI_Rn01_00032612 predicted 1171
3 SASI_Rn01_00032613 predicted 1229
4 SASI_Rn01_00032614 predicted 1270
5 SASI_Rn01_00032615 predicted 805
6 SASI_Rn01_00032616 predicted 885
7 SASI_Rn01_00032617 predicted 1302
8 SASI_Rn01_00032618 predicted 733
9 SASI_Rn01_00032619 predicted 1292
10 SASI_Rn01_00032620 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055303 predicted 661
2 SASI_Mm02_00336614 predicted 1498
3 SASI_Mm02_00336615 predicted 760
4 SASI_Mm01_00055309 predicted 829
5 SASI_Mm02_00336616 predicted 670
6 SASI_Mm01_00055310 predicted 754
7 SASI_Mm01_00055312 predicted 909
8 SASI_Mm02_00336617 predicted 828
9 SASI_Mm02_00336618 predicted 1008
10 SASI_Mm02_00336619 predicted 655
11 SASI_Mm01_00055304 predicted 1290
12 SASI_Mm01_00055305 predicted 1402
13 SASI_Mm01_00055306 predicted 1127
14 SASI_Mm01_00055307 predicted 1146
15 SASI_Mm01_00055308 predicted 1137
16 SASI_Mm01_00055311 predicted 1304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153810
VALIDATED
CACUL1 MISSION shRNA Bacterial Glycerol Stock
CDK2-associated, cullin domain 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1536s21c1
Sequence:CCGGGGGATGAGTTGGCTTATAATACTCGAGTATTATAAGCCAACTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153810.4-1858s21c1
Sequence:CCGGCATCTCAGAAAGTGACCATTTCTCGAGAAATGGTCACTTTCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-872s21c1
Sequence:CCGGGAAGATTATAAGAGCACATACCTCGAGGTATGTGCTCTTATAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153810.4-2027s21c1
Sequence:CCGGACCAAGCAGATCATTACAGTACTCGAGTACTGTAATGATCTGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1222s21c1
Sequence:CCGGTGACCTTATAAAGCTGTTTACCTCGAGGTAAACAGCTTTATAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-932s21c1
Sequence:CCGGCAGAGTCCTGGTGACTATATCCTCGAGGATATAGTCACCAGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1085s21c1
Sequence:CCGGAGCCCTCCAGATCTCTATATTCTCGAGAATATAGAGATCTGGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1292s21c1
Sequence:CCGGGAAGCCCAGTCAACACCATTTCTCGAGAAATGGTGTTGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-905s1c1
Sequence:CCGGGATGGTGCCATAGATCAACTTCTCGAGAAGTTGATCTATGGCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-1047s1c1
Sequence:CCGGCTAATCACTTAGAGAGAGTCTCTCGAGAGACTCTCTCTAAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-1320s1c1
Sequence:CCGGCACCTTCAACTATGGCAAATACTCGAGTATTTGCCATAGTTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-985s1c1
Sequence:CCGGGTATAAATGTGTATGCCAGCACTCGAGTGCTGGCATACACATTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153810
VALIDATED
CACUL1 MISSION shRNA shRNA Plasmid DNA
CDK2-associated, cullin domain 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1536s21c1
Sequence:CCGGGGGATGAGTTGGCTTATAATACTCGAGTATTATAAGCCAACTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153810.4-1858s21c1
Sequence:CCGGCATCTCAGAAAGTGACCATTTCTCGAGAAATGGTCACTTTCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-872s21c1
Sequence:CCGGGAAGATTATAAGAGCACATACCTCGAGGTATGTGCTCTTATAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153810.4-2027s21c1
Sequence:CCGGACCAAGCAGATCATTACAGTACTCGAGTACTGTAATGATCTGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1222s21c1
Sequence:CCGGTGACCTTATAAAGCTGTTTACCTCGAGGTAAACAGCTTTATAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-932s21c1
Sequence:CCGGCAGAGTCCTGGTGACTATATCCTCGAGGATATAGTCACCAGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1085s21c1
Sequence:CCGGAGCCCTCCAGATCTCTATATTCTCGAGAATATAGAGATCTGGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1292s21c1
Sequence:CCGGGAAGCCCAGTCAACACCATTTCTCGAGAAATGGTGTTGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-905s1c1
Sequence:CCGGGATGGTGCCATAGATCAACTTCTCGAGAAGTTGATCTATGGCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-1047s1c1
Sequence:CCGGCTAATCACTTAGAGAGAGTCTCTCGAGAGACTCTCTCTAAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-1320s1c1
Sequence:CCGGCACCTTCAACTATGGCAAATACTCGAGTATTTGCCATAGTTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-985s1c1
Sequence:CCGGGTATAAATGTGTATGCCAGCACTCGAGTGCTGGCATACACATTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153810
VALIDATED
CACUL1 MISSION shRNA Lentiviral Transduction Particles
CDK2-associated, cullin domain 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1536s21c1
Sequence:CCGGGGGATGAGTTGGCTTATAATACTCGAGTATTATAAGCCAACTCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153810.4-1858s21c1
Sequence:CCGGCATCTCAGAAAGTGACCATTTCTCGAGAAATGGTCACTTTCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-872s21c1
Sequence:CCGGGAAGATTATAAGAGCACATACCTCGAGGTATGTGCTCTTATAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153810.4-2027s21c1
Sequence:CCGGACCAAGCAGATCATTACAGTACTCGAGTACTGTAATGATCTGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1222s21c1
Sequence:CCGGTGACCTTATAAAGCTGTTTACCTCGAGGTAAACAGCTTTATAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-932s21c1
Sequence:CCGGCAGAGTCCTGGTGACTATATCCTCGAGGATATAGTCACCAGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1085s21c1
Sequence:CCGGAGCCCTCCAGATCTCTATATTCTCGAGAATATAGAGATCTGGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153810.4-1292s21c1
Sequence:CCGGGAAGCCCAGTCAACACCATTTCTCGAGAAATGGTGTTGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-905s1c1
Sequence:CCGGGATGGTGCCATAGATCAACTTCTCGAGAAGTTGATCTATGGCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-1047s1c1
Sequence:CCGGCTAATCACTTAGAGAGAGTCTCTCGAGAGACTCTCTCTAAGTGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-1320s1c1
Sequence:CCGGCACCTTCAACTATGGCAAATACTCGAGTATTTGCCATAGTTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153810.2-985s1c1
Sequence:CCGGGTATAAATGTGTATGCCAGCACTCGAGTGCTGGCATACACATTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030197
VALIDATED
CACUL1 MISSION shRNA Bacterial Glycerol Stock
CDK2-associated, cullin domain 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030197.1-318s21c1
Sequence:CCGGGCAATGATGGACGACCAGAATCTCGAGATTCTGGTCGTCCATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030197.1-1529s21c1
Sequence:CCGGCCGGACTTCTTTCTTTGATTTCTCGAGAAATCAAAGAAAGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030197.1-332s21c1
Sequence:CCGGCCAGAATCACAACAACTGGGACTCGAGTCCCAGTTGTTGTGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030197.1-1694s21c1
Sequence:CCGGCCTCCAGAAATACAAGAACAACTCGAGTTGTTCTTGTATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-318s1c1
Sequence:CCGGGCAATGATGGACGACCAGAATCTCGAGATTCTGGTCGTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030197.1-1694s1c1
Sequence:CCGGCCTCCAGAAATACAAGAACAACTCGAGTTGTTCTTGTATTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-1107s1c1
Sequence:CCGGGAAGCCCAGTCAACACCATTTCTCGAGAAATGGTGTTGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030197.1-1529s1c1
Sequence:CCGGCCGGACTTCTTTCTTTGATTTCTCGAGAAATCAAAGAAAGAAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-332s1c1
Sequence:CCGGCCAGAATCACAACAACTGGGACTCGAGTCCCAGTTGTTGTGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030197
VALIDATED
CACUL1 MISSION shRNA shRNA Plasmid DNA
CDK2-associated, cullin domain 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030197.1-318s21c1
Sequence:CCGGGCAATGATGGACGACCAGAATCTCGAGATTCTGGTCGTCCATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030197.1-1529s21c1
Sequence:CCGGCCGGACTTCTTTCTTTGATTTCTCGAGAAATCAAAGAAAGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030197.1-332s21c1
Sequence:CCGGCCAGAATCACAACAACTGGGACTCGAGTCCCAGTTGTTGTGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030197.1-1694s21c1
Sequence:CCGGCCTCCAGAAATACAAGAACAACTCGAGTTGTTCTTGTATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-318s1c1
Sequence:CCGGGCAATGATGGACGACCAGAATCTCGAGATTCTGGTCGTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030197.1-1694s1c1
Sequence:CCGGCCTCCAGAAATACAAGAACAACTCGAGTTGTTCTTGTATTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-1107s1c1
Sequence:CCGGGAAGCCCAGTCAACACCATTTCTCGAGAAATGGTGTTGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030197.1-1529s1c1
Sequence:CCGGCCGGACTTCTTTCTTTGATTTCTCGAGAAATCAAAGAAAGAAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-332s1c1
Sequence:CCGGCCAGAATCACAACAACTGGGACTCGAGTCCCAGTTGTTGTGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030197
VALIDATED
CACUL1 MISSION shRNA Lentiviral Transduction Particles
CDK2-associated, cullin domain 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030197.1-318s21c1
Sequence:CCGGGCAATGATGGACGACCAGAATCTCGAGATTCTGGTCGTCCATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030197.1-1529s21c1
Sequence:CCGGCCGGACTTCTTTCTTTGATTTCTCGAGAAATCAAAGAAAGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030197.1-332s21c1
Sequence:CCGGCCAGAATCACAACAACTGGGACTCGAGTCCCAGTTGTTGTGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030197.1-1694s21c1
Sequence:CCGGCCTCCAGAAATACAAGAACAACTCGAGTTGTTCTTGTATTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-318s1c1
Sequence:CCGGGCAATGATGGACGACCAGAATCTCGAGATTCTGGTCGTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030197.1-1694s1c1
Sequence:CCGGCCTCCAGAAATACAAGAACAACTCGAGTTGTTCTTGTATTTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-1107s1c1
Sequence:CCGGGAAGCCCAGTCAACACCATTTCTCGAGAAATGGTGTTGACTGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030197.1-1529s1c1
Sequence:CCGGCCGGACTTCTTTCTTTGATTTCTCGAGAAATCAAAGAAAGAAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030197.1-332s1c1
Sequence:CCGGCCAGAATCACAACAACTGGGACTCGAGTCCCAGTTGTTGTGATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks