EMAIL THIS PAGE TO A FRIEND

CACYBP

calcyclin binding protein

78 Gene Product Result for
Synonyms: GIG5 RP1-102G20.6 S100A6BP SIP
UniProtKB ID: Q9HB71, B2ZWH2, B3KSF1, O60666, Q5R370, Q5R371
Gene ID:
Human(27101) Summary: The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12301) calcyclin binding protein
Rat(289144) calcyclin binding protein
naked mole-rat(101697007) calcyclin binding protein
domestic guinea pig(100717855) calcyclin binding protein
sheep(101116245) calcyclin binding protein
Zebrafish(405823) calcyclin binding protein
cow(618428) calcyclin binding protein
domestic cat(101097613) calcyclin binding protein
dog(480062) calcyclin binding protein
chicken(424437) calcyclin binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C8120 Anti-CACYBP (211-225) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C7995 Anti-CACYBP (71-85) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1407335 Anti-CACYBP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV51259 Anti-CACYBP antibody produced in rabbit IgG fraction of antiserum rat, horse, rabbit, bovine, human, canine, mouse, guinea pig
western blot pricing
HPA025753 Anti-CACYBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA057038 Anti-CACYBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0027101M1 Monoclonal Anti-CACYBP antibody produced in mouse clone 2E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200187 Monoclonal Anti-CACYBP antibody produced in mouse ~1.0 mg/mL, clone CABP7, purified immunoglobulin bovine, canine, human, monkey
western blot pricing
SAB1405030 Monoclonal Anti-CACYBP antibody produced in mouse clone 2E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014412 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007214 Rosetta Predictions human pricing
NM_014412 Rosetta Predictions human pricing
NM_001004208 Rosetta Predictions rat pricing
NM_009786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023031 predicted 601
2 SASI_Hs01_00023032 predicted 684
3 SASI_Hs01_00023033 predicted 985
4 SASI_Hs01_00023034 predicted 969
5 SASI_Hs01_00023035 predicted 791
6 SASI_Hs01_00023036 predicted 843
7 SASI_Hs01_00023037 predicted 609
8 SASI_Hs01_00023038 predicted 723
9 SASI_Hs01_00023039 predicted 769
10 SASI_Hs02_00305249 predicted 591
11 SASI_Hs01_00023040 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130531 predicted 788
2 SASI_Hs01_00130532 predicted 872
3 SASI_Hs01_00130533 predicted 1166
4 SASI_Hs01_00130534 predicted 1148
5 SASI_Hs01_00130535 predicted 981
6 SASI_Hs01_00130536 predicted 1030
7 SASI_Hs01_00130537 predicted 799
8 SASI_Hs01_00130538 predicted 907
9 SASI_Hs01_00130539 predicted 956
10 SASI_Hs02_00345603 predicted 777
11 SASI_Hs01_00130540 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080519 predicted 300
2 SASI_Rn01_00080520 predicted 578
3 SASI_Rn01_00080521 predicted 599
4 SASI_Rn01_00080522 predicted 911
5 SASI_Rn01_00080523 predicted 638
6 SASI_Rn01_00080524 predicted 705
7 SASI_Rn01_00080525 predicted 825
8 SASI_Rn01_00080526 predicted 347
9 SASI_Rn01_00080527 predicted 718
10 SASI_Rn02_00198187 predicted 447
11 SASI_Rn01_00080528 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186015 predicted 937
2 SASI_Mm01_00186017 predicted 871
3 SASI_Mm01_00186018 predicted 856
4 SASI_Mm01_00186019 predicted 828
5 SASI_Mm01_00186020 predicted 948
6 SASI_Mm01_00186021 predicted 604
7 SASI_Mm01_00186022 predicted 833
8 SASI_Mm02_00317025 predicted 948
9 SASI_Mm02_00317026 predicted 874
10 SASI_Mm02_00317027 predicted 676
11 SASI_Mm01_00186016 predicted 965
12 SASI_Mm01_00186023 predicted 551
13 SASI_Mm01_00186024 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014412
VALIDATED
CACYBP MISSION shRNA Bacterial Glycerol Stock
calcyclin binding protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014412.1-726s1c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-237s1c1
Sequence:CCGGCAAGAACAAGATGCAACAGAACTCGAGTTCTGTTGCATCTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014412.1-249s1c1
Sequence:CCGGGCAACAGAAATCACAGAAGAACTCGAGTTCTTCTGTGATTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-607s1c1
Sequence:CCGGGATTACCTGACCCAGGTTGAACTCGAGTTCAACCTGGGTCAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-486s1c1
Sequence:CCGGGAGTTACTCCATGATTGTGAACTCGAGTTCACAATCATGGAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-406s1c1
Sequence:CCGGCATCAAGTTCCCACTGAGAATCTCGAGATTCTCAGTGGGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014412.1-781s1c1
Sequence:CCGGGCCAAAGGAGACACGGAATTTCTCGAGAAATTCCGTGTCTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-915s21c1
Sequence:CCGGGATTACCTGACCCAGGTTGAACTCGAGTTCAACCTGGGTCAGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-714s21c1
Sequence:CCGGCATCAAGTTCCCACTGAGAATCTCGAGATTCTCAGTGGGAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-794s21c1
Sequence:CCGGGAGTTACTCCATGATTGTGAACTCGAGTTCACAATCATGGAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-545s21c1
Sequence:CCGGCAAGAACAAGATGCAACAGAACTCGAGTTCTGTTGCATCTTGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-1034s21c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014412
VALIDATED
CACYBP MISSION shRNA shRNA Plasmid DNA
calcyclin binding protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014412.1-726s1c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-237s1c1
Sequence:CCGGCAAGAACAAGATGCAACAGAACTCGAGTTCTGTTGCATCTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014412.1-249s1c1
Sequence:CCGGGCAACAGAAATCACAGAAGAACTCGAGTTCTTCTGTGATTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-607s1c1
Sequence:CCGGGATTACCTGACCCAGGTTGAACTCGAGTTCAACCTGGGTCAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-486s1c1
Sequence:CCGGGAGTTACTCCATGATTGTGAACTCGAGTTCACAATCATGGAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-406s1c1
Sequence:CCGGCATCAAGTTCCCACTGAGAATCTCGAGATTCTCAGTGGGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014412.1-781s1c1
Sequence:CCGGGCCAAAGGAGACACGGAATTTCTCGAGAAATTCCGTGTCTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-915s21c1
Sequence:CCGGGATTACCTGACCCAGGTTGAACTCGAGTTCAACCTGGGTCAGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-714s21c1
Sequence:CCGGCATCAAGTTCCCACTGAGAATCTCGAGATTCTCAGTGGGAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-794s21c1
Sequence:CCGGGAGTTACTCCATGATTGTGAACTCGAGTTCACAATCATGGAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-545s21c1
Sequence:CCGGCAAGAACAAGATGCAACAGAACTCGAGTTCTGTTGCATCTTGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-1034s21c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014412
VALIDATED
CACYBP MISSION shRNA Lentiviral Transduction Particles
calcyclin binding protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014412.1-726s1c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-237s1c1
Sequence:CCGGCAAGAACAAGATGCAACAGAACTCGAGTTCTGTTGCATCTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014412.1-249s1c1
Sequence:CCGGGCAACAGAAATCACAGAAGAACTCGAGTTCTTCTGTGATTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-607s1c1
Sequence:CCGGGATTACCTGACCCAGGTTGAACTCGAGTTCAACCTGGGTCAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-486s1c1
Sequence:CCGGGAGTTACTCCATGATTGTGAACTCGAGTTCACAATCATGGAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014412.1-406s1c1
Sequence:CCGGCATCAAGTTCCCACTGAGAATCTCGAGATTCTCAGTGGGAACTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014412.1-781s1c1
Sequence:CCGGGCCAAAGGAGACACGGAATTTCTCGAGAAATTCCGTGTCTCCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-915s21c1
Sequence:CCGGGATTACCTGACCCAGGTTGAACTCGAGTTCAACCTGGGTCAGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-714s21c1
Sequence:CCGGCATCAAGTTCCCACTGAGAATCTCGAGATTCTCAGTGGGAACTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-794s21c1
Sequence:CCGGGAGTTACTCCATGATTGTGAACTCGAGTTCACAATCATGGAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-545s21c1
Sequence:CCGGCAAGAACAAGATGCAACAGAACTCGAGTTCTGTTGCATCTTGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014412.2-1034s21c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009786
VALIDATED
CACYBP MISSION shRNA Bacterial Glycerol Stock
calcyclin binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-722s1c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-1016s1c1
Sequence:CCGGCCCAGACATTTCGTTTCAGAACTCGAGTTCTGAAACGAAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-248s1c1
Sequence:CCGGGCAACAGAAGTCGCAGAAGAACTCGAGTTCTTCTGCGACTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-357s1c1
Sequence:CCGGCAGTCAGATAAGTTTGTGAAACTCGAGTTTCACAAACTTATCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-218s1c1
Sequence:CCGGCAAGATTGAGACGGAACTCAACTCGAGTTGAGTTCCGTCTCAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-722s21c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-248s21c1
Sequence:CCGGGCAACAGAAGTCGCAGAAGAACTCGAGTTCTTCTGCGACTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-218s21c1
Sequence:CCGGCAAGATTGAGACGGAACTCAACTCGAGTTGAGTTCCGTCTCAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009786.1-1016s21c1
Sequence:CCGGCCCAGACATTTCGTTTCAGAACTCGAGTTCTGAAACGAAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-357s21c1
Sequence:CCGGCAGTCAGATAAGTTTGTGAAACTCGAGTTTCACAAACTTATCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009786
VALIDATED
CACYBP MISSION shRNA shRNA Plasmid DNA
calcyclin binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-722s1c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-1016s1c1
Sequence:CCGGCCCAGACATTTCGTTTCAGAACTCGAGTTCTGAAACGAAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-248s1c1
Sequence:CCGGGCAACAGAAGTCGCAGAAGAACTCGAGTTCTTCTGCGACTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-357s1c1
Sequence:CCGGCAGTCAGATAAGTTTGTGAAACTCGAGTTTCACAAACTTATCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-218s1c1
Sequence:CCGGCAAGATTGAGACGGAACTCAACTCGAGTTGAGTTCCGTCTCAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-722s21c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-248s21c1
Sequence:CCGGGCAACAGAAGTCGCAGAAGAACTCGAGTTCTTCTGCGACTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-218s21c1
Sequence:CCGGCAAGATTGAGACGGAACTCAACTCGAGTTGAGTTCCGTCTCAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009786.1-1016s21c1
Sequence:CCGGCCCAGACATTTCGTTTCAGAACTCGAGTTCTGAAACGAAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-357s21c1
Sequence:CCGGCAGTCAGATAAGTTTGTGAAACTCGAGTTTCACAAACTTATCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009786
VALIDATED
CACYBP MISSION shRNA Lentiviral Transduction Particles
calcyclin binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-722s1c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-1016s1c1
Sequence:CCGGCCCAGACATTTCGTTTCAGAACTCGAGTTCTGAAACGAAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-248s1c1
Sequence:CCGGGCAACAGAAGTCGCAGAAGAACTCGAGTTCTTCTGCGACTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-357s1c1
Sequence:CCGGCAGTCAGATAAGTTTGTGAAACTCGAGTTTCACAAACTTATCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009786.1-218s1c1
Sequence:CCGGCAAGATTGAGACGGAACTCAACTCGAGTTGAGTTCCGTCTCAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-722s21c1
Sequence:CCGGCGATGATATGAAGCGAACCATCTCGAGATGGTTCGCTTCATATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-248s21c1
Sequence:CCGGGCAACAGAAGTCGCAGAAGAACTCGAGTTCTTCTGCGACTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-218s21c1
Sequence:CCGGCAAGATTGAGACGGAACTCAACTCGAGTTGAGTTCCGTCTCAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009786.1-1016s21c1
Sequence:CCGGCCCAGACATTTCGTTTCAGAACTCGAGTTCTGAAACGAAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009786.1-357s21c1
Sequence:CCGGCAGTCAGATAAGTTTGTGAAACTCGAGTTTCACAAACTTATCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks