EMAIL THIS PAGE TO A FRIEND

CAD

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

61 Gene Product Result for
UniProtKB ID: P27708, D6W552, Q6P0Q0
Gene ID:
Human(790) Summary: The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. [provided by RefSeq, Jul 2008]
Mouse(69719) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Rat(24240) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Zebrafish(266992) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
cow(504261) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Horse(100055366) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
domestic cat(101091102) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
dog(483009) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
chicken(428659) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
sheep(101115776) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Domestic Rabbit(100352236) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
domestic guinea pig(100727133) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
naked mole-rat(101710382) carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_131981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004341 Rosetta Predictions human pricing
NM_001105710 Rosetta Predictions rat pricing
NM_023525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061442 predicted 793
2 SASI_Hs01_00061443 predicted 3699
3 SASI_Hs02_00337398 predicted 2354
4 SASI_Hs02_00337399 predicted 3124
5 SASI_Hs01_00061445 predicted 291
6 SASI_Hs01_00061446 predicted 1517
7 SASI_Hs01_00061447 predicted 925
8 SASI_Hs01_00061448 predicted 2428
9 SASI_Hs01_00061450 predicted 6629
10 SASI_Hs01_00061451 predicted 2984
11 SASI_Hs01_00061444 predicted 3913
12 SASI_Hs01_00061449 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211766 predicted 2251
2 SASI_Rn02_00211767 predicted 2197
3 SASI_Rn02_00211768 predicted 1118
4 SASI_Rn02_00211769 predicted 5955
5 SASI_Rn02_00211770 predicted 3171
6 SASI_Rn02_00211771 predicted 788
7 SASI_Rn02_00211772 predicted 1542
8 SASI_Rn02_00211773 predicted 938
9 SASI_Rn02_00211774 predicted 2789
10 SASI_Rn02_00211775 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023929 predicted 4995
2 SASI_Mm01_00023931 predicted 6124
3 SASI_Mm01_00023932 predicted 287
4 SASI_Mm01_00023933 predicted 5920
5 SASI_Mm02_00327166 predicted 2090
6 SASI_Mm01_00023935 predicted 1514
7 SASI_Mm01_00023936 predicted 1315
8 SASI_Mm02_00327167 predicted 1390
9 SASI_Mm01_00023937 predicted 770
10 SASI_Mm01_00023938 predicted 1372
11 SASI_Mm01_00023930 predicted 2228
12 SASI_Mm01_00023934 predicted 5941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023525
VALIDATED
CAD MISSION shRNA Bacterial Glycerol Stock
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023525.1-855s21c1
Sequence:CCGGCCGAGTCTTGTCTGAACCTAACTCGAGTTAGGTTCAGACAAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-6935s21c1
Sequence:CCGGCAAGCACATAGATGTACTAAACTCGAGTTTAGTACATCTATGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-1317s21c1
Sequence:CCGGGCCTCCACGAAAGGTTCTAATCTCGAGATTAGAACCTTTCGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-1387s21c1
Sequence:CCGGTCGGGCTCTCAGGCAATTAAACTCGAGTTTAATTGCCTGAGAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-3027s21c1
Sequence:CCGGGCTCCGGAAGATGGGTTATAACTCGAGTTATAACCCATCTTCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023525
VALIDATED
CAD MISSION shRNA shRNA Plasmid DNA
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023525.1-855s21c1
Sequence:CCGGCCGAGTCTTGTCTGAACCTAACTCGAGTTAGGTTCAGACAAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-6935s21c1
Sequence:CCGGCAAGCACATAGATGTACTAAACTCGAGTTTAGTACATCTATGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-1317s21c1
Sequence:CCGGGCCTCCACGAAAGGTTCTAATCTCGAGATTAGAACCTTTCGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-1387s21c1
Sequence:CCGGTCGGGCTCTCAGGCAATTAAACTCGAGTTTAATTGCCTGAGAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-3027s21c1
Sequence:CCGGGCTCCGGAAGATGGGTTATAACTCGAGTTATAACCCATCTTCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023525
VALIDATED
CAD MISSION shRNA Lentiviral Transduction Particles
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023525.1-855s21c1
Sequence:CCGGCCGAGTCTTGTCTGAACCTAACTCGAGTTAGGTTCAGACAAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-6935s21c1
Sequence:CCGGCAAGCACATAGATGTACTAAACTCGAGTTTAGTACATCTATGTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-1317s21c1
Sequence:CCGGGCCTCCACGAAAGGTTCTAATCTCGAGATTAGAACCTTTCGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-1387s21c1
Sequence:CCGGTCGGGCTCTCAGGCAATTAAACTCGAGTTTAATTGCCTGAGAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023525.1-3027s21c1
Sequence:CCGGGCTCCGGAAGATGGGTTATAACTCGAGTTATAACCCATCTTCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004341
VALIDATED
CAD MISSION shRNA Bacterial Glycerol Stock
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-1405s21c1
Sequence:CCGGTCGGGCTCTCAGGCAATTAAGCTCGAGCTTAATTGCCTGAGAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-3045s21c1
Sequence:CCGGGCTCCGAAAGATGGGATATAACTCGAGTTATATCCCATCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-351s21c1
Sequence:CCGGCCCAGATGAAATGGATGAGTTCTCGAGAACTCATCCATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-6598s21c1
Sequence:CCGGCGAATCCAGAAGGAACGATTTCTCGAGAAATCGTTCCTTCTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004341.3-6910s21c1
Sequence:CCGGGGGCAGCACACTTAGATATTCCTCGAGGAATATCTAAGTGTGCTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-4889s1c1
Sequence:CCGGCCTGCTAATTAAAGCTGCAAACTCGAGTTTGCAGCTTTAATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-6462s1c1
Sequence:CCGGCGAATCCAGAAGGAACGATTTCTCGAGAAATCGTTCCTTCTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-2222s1c1
Sequence:CCGGCGTGGATTATTGTGTGGTGAACTCGAGTTCACCACACAATAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-215s1c1
Sequence:CCGGCCCAGATGAAATGGATGAGTTCTCGAGAACTCATCCATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-2909s1c1
Sequence:CCGGGCTCCGAAAGATGGGATATAACTCGAGTTATATCCCATCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004341
VALIDATED
CAD MISSION shRNA shRNA Plasmid DNA
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-1405s21c1
Sequence:CCGGTCGGGCTCTCAGGCAATTAAGCTCGAGCTTAATTGCCTGAGAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-3045s21c1
Sequence:CCGGGCTCCGAAAGATGGGATATAACTCGAGTTATATCCCATCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-351s21c1
Sequence:CCGGCCCAGATGAAATGGATGAGTTCTCGAGAACTCATCCATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-6598s21c1
Sequence:CCGGCGAATCCAGAAGGAACGATTTCTCGAGAAATCGTTCCTTCTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004341.3-6910s21c1
Sequence:CCGGGGGCAGCACACTTAGATATTCCTCGAGGAATATCTAAGTGTGCTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-4889s1c1
Sequence:CCGGCCTGCTAATTAAAGCTGCAAACTCGAGTTTGCAGCTTTAATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-6462s1c1
Sequence:CCGGCGAATCCAGAAGGAACGATTTCTCGAGAAATCGTTCCTTCTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-2222s1c1
Sequence:CCGGCGTGGATTATTGTGTGGTGAACTCGAGTTCACCACACAATAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-215s1c1
Sequence:CCGGCCCAGATGAAATGGATGAGTTCTCGAGAACTCATCCATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-2909s1c1
Sequence:CCGGGCTCCGAAAGATGGGATATAACTCGAGTTATATCCCATCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004341
VALIDATED
CAD MISSION shRNA Lentiviral Transduction Particles
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-1405s21c1
Sequence:CCGGTCGGGCTCTCAGGCAATTAAGCTCGAGCTTAATTGCCTGAGAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-3045s21c1
Sequence:CCGGGCTCCGAAAGATGGGATATAACTCGAGTTATATCCCATCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-351s21c1
Sequence:CCGGCCCAGATGAAATGGATGAGTTCTCGAGAACTCATCCATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004341.3-6598s21c1
Sequence:CCGGCGAATCCAGAAGGAACGATTTCTCGAGAAATCGTTCCTTCTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004341.3-6910s21c1
Sequence:CCGGGGGCAGCACACTTAGATATTCCTCGAGGAATATCTAAGTGTGCTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-4889s1c1
Sequence:CCGGCCTGCTAATTAAAGCTGCAAACTCGAGTTTGCAGCTTTAATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-6462s1c1
Sequence:CCGGCGAATCCAGAAGGAACGATTTCTCGAGAAATCGTTCCTTCTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-2222s1c1
Sequence:CCGGCGTGGATTATTGTGTGGTGAACTCGAGTTCACCACACAATAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-215s1c1
Sequence:CCGGCCCAGATGAAATGGATGAGTTCTCGAGAACTCATCCATTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004341.2-2909s1c1
Sequence:CCGGGCTCCGAAAGATGGGATATAACTCGAGTTATATCCCATCTTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131981
VALIDATED
CAD MISSION shRNA Bacterial Glycerol Stock
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131981.5-3303s1c1
Sequence:CCGGGCTCCTAGATACCATCGGTATCTCGAGATACCGATGGTATCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-270s1c1
Sequence:CCGGCCCTTCCTACAAAGCTCAGATCTCGAGATCTGAGCTTTGTAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-1317s1c1
Sequence:CCGGGCCTCCACGAAAGGTTCTAATCTCGAGATTAGAACCTTTCGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-5934s1c1
Sequence:CCGGGCAGTTCACTAAGGATCAGATCTCGAGATCTGATCCTTAGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-855s1c1
Sequence:CCGGCCGAGTCTTGTCTGAACCTAACTCGAGTTAGGTTCAGACAAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131981
VALIDATED
CAD MISSION shRNA shRNA Plasmid DNA
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131981.5-3303s1c1
Sequence:CCGGGCTCCTAGATACCATCGGTATCTCGAGATACCGATGGTATCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-270s1c1
Sequence:CCGGCCCTTCCTACAAAGCTCAGATCTCGAGATCTGAGCTTTGTAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-1317s1c1
Sequence:CCGGGCCTCCACGAAAGGTTCTAATCTCGAGATTAGAACCTTTCGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-5934s1c1
Sequence:CCGGGCAGTTCACTAAGGATCAGATCTCGAGATCTGATCCTTAGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-855s1c1
Sequence:CCGGCCGAGTCTTGTCTGAACCTAACTCGAGTTAGGTTCAGACAAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131981
VALIDATED
CAD MISSION shRNA Lentiviral Transduction Particles
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131981.5-3303s1c1
Sequence:CCGGGCTCCTAGATACCATCGGTATCTCGAGATACCGATGGTATCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-270s1c1
Sequence:CCGGCCCTTCCTACAAAGCTCAGATCTCGAGATCTGAGCTTTGTAGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-1317s1c1
Sequence:CCGGGCCTCCACGAAAGGTTCTAATCTCGAGATTAGAACCTTTCGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-5934s1c1
Sequence:CCGGGCAGTTCACTAAGGATCAGATCTCGAGATCTGATCCTTAGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_131981.5-855s1c1
Sequence:CCGGCCGAGTCTTGTCTGAACCTAACTCGAGTTAGGTTCAGACAAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks