EMAIL THIS PAGE TO A FRIEND

CADM1

cell adhesion molecule 1

251 Gene Product Result for
Synonyms: BL2 IGSF4 IGSF4A NECL2 Necl-2 RA175 ST17 SYNCAM TSLC1 sTSLC-1 sgIGSF synCAM1
Gene ID:
Mouse(54725) cell adhesion molecule 1
Rat(363058) cell adhesion molecule 1
naked mole-rat(101720476) cell adhesion molecule 1
domestic guinea pig(100730649) cell adhesion molecule 1
sheep(101115479) cell adhesion molecule 1
chicken(419762) cell adhesion molecule 1
domestic cat(101083958) cell adhesion molecule 1
cow(529873) cell adhesion molecule 1
Horse(100062374) cell adhesion molecule 1
dog(479432) cell adhesion molecule 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP6470 CADM1 human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014333 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098517 Rosetta Predictions human pricing
NM_014333 Rosetta Predictions human pricing
NM_001012201 Rosetta Predictions rat pricing
XM_576404 Rosetta Predictions rat pricing
NM_001025600 Rosetta Predictions mouse pricing
NM_018770 Rosetta Predictions mouse pricing
NM_207675 Rosetta Predictions mouse pricing
NM_207676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319227 predicted 553
2 SASI_Hs02_00319228 predicted 730
3 SASI_Hs02_00319229 predicted 412
4 SASI_Hs02_00319230 predicted 447
5 SASI_Hs02_00319231 predicted 562
6 SASI_Hs02_00319232 predicted 855
7 SASI_Hs02_00319233 predicted 868
8 SASI_Hs02_00319234 predicted 853
9 SASI_Hs02_00319235 predicted 828
10 SASI_Hs02_00319236 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099762 predicted 557
2 SASI_Hs02_00345463 predicted 725
3 SASI_Hs01_00099763 predicted 404
4 SASI_Hs01_00099766 predicted 448
5 SASI_Hs02_00345464 predicted 563
6 SASI_Hs02_00345465 predicted 851
7 SASI_Hs01_00099767 predicted 867
8 SASI_Hs02_00345466 predicted 859
9 SASI_Hs01_00099765 predicted 824
10 SASI_Hs01_00099769 predicted 712
11 SASI_Hs01_00099764 predicted 789
12 SASI_Hs01_00099768 predicted 454
13 SASI_Hs01_00099770 predicted 311
14 SASI_Hs01_00099771 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110482 predicted 599
2 SASI_Rn01_00110483 predicted 599
3 SASI_Rn01_00110484 predicted 870
4 SASI_Rn01_00110486 predicted 741
5 SASI_Rn01_00110487 predicted 491
6 SASI_Rn01_00110488 predicted 570
7 SASI_Rn02_00200429 predicted 915
8 SASI_Rn02_00200430 predicted 727
9 SASI_Rn01_00110489 predicted 896
10 SASI_Rn01_00110491 predicted 762
11 SASI_Rn01_00110485 predicted 535
12 SASI_Rn01_00110490 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174589 predicted 608
2 SASI_Rn01_00174590 predicted 606
3 SASI_Rn01_00174591 predicted 873
4 SASI_Rn01_00174592 predicted 537
5 SASI_Rn01_00174593 predicted 751
6 SASI_Rn01_00174594 predicted 488
7 SASI_Rn01_00174595 predicted 574
8 SASI_Rn01_00174596 predicted 731
9 SASI_Rn01_00174597 predicted 898
10 SASI_Rn01_00174598 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038162 predicted 457
2 SASI_Mm01_00038163 predicted 341
3 SASI_Mm01_00038165 predicted 463
4 SASI_Mm01_00038166 predicted 421
5 SASI_Mm02_00287962 predicted 912
6 SASI_Mm02_00287963 predicted 812
7 SASI_Mm02_00287964 predicted 558
8 SASI_Mm01_00038169 predicted 743
9 SASI_Mm01_00038170 predicted 420
10 SASI_Mm02_00287965 predicted 916
11 SASI_Mm01_00038164 predicted 737
12 SASI_Mm01_00038167 predicted 384
13 SASI_Mm01_00038168 predicted 738
14 SASI_Mm01_00038171 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052027 predicted 451
2 SASI_Mm01_00052028 predicted 341
3 SASI_Mm01_00052030 predicted 460
4 SASI_Mm01_00052031 predicted 423
5 SASI_Mm01_00052032 predicted 372
6 SASI_Mm02_00324081 predicted 559
7 SASI_Mm01_00052034 predicted 748
8 SASI_Mm01_00052035 predicted 418
9 SASI_Mm01_00052036 predicted 351
10 SASI_Mm02_00324082 predicted 572
11 SASI_Mm01_00052029 predicted 734
12 SASI_Mm01_00052033 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032024 predicted 456
2 SASI_Mm01_00032025 predicted 343
3 SASI_Mm01_00032027 predicted 457
4 SASI_Mm01_00032028 predicted 430
5 SASI_Mm01_00032029 predicted 373
6 SASI_Mm02_00352202 predicted 556
7 SASI_Mm01_00032031 predicted 747
8 SASI_Mm01_00032032 predicted 420
9 SASI_Mm01_00032033 predicted 352
10 SASI_Mm02_00352203 predicted 577
11 SASI_Mm01_00032026 predicted 740
12 SASI_Mm01_00032030 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184886 predicted 455
2 SASI_Mm01_00184887 predicted 348
3 SASI_Mm01_00184889 predicted 458
4 SASI_Mm01_00184890 predicted 430
5 SASI_Mm01_00184891 predicted 379
6 SASI_Mm02_00352204 predicted 556
7 SASI_Mm01_00184893 predicted 748
8 SASI_Mm01_00184894 predicted 422
9 SASI_Mm01_00184895 predicted 353
10 SASI_Mm02_00352205 predicted 581
11 SASI_Mm01_00184888 predicted 736
12 SASI_Mm01_00184892 predicted 734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207675
VALIDATED
CADM1 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-1320s1c1
Sequence:CCGGCGCAGACACAGCTATAATCAACTCGAGTTGATTATAGCTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207675.2-460s1c1
Sequence:CCGGCCACGTAACTTGATGATCGATCTCGAGATCGATCATCAAGTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-734s1c1
Sequence:CCGGGCTATCTAGAAGTGCAGTATACTCGAGTATACTGCACTTCTAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-921s1c1
Sequence:CCGGCCTGTTCATCAATAACCTAAACTCGAGTTTAGGTTATTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-3423s1c1
Sequence:CCGGCGGACTGGTTTGTAAAGGAAACTCGAGTTTCCTTTACAAACCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207675.2-1709s21c1
Sequence:CCGGGGATTTGGTTTCGGTAGATTGCTCGAGCAATCTACCGAAACCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-734s21c1
Sequence:CCGGGCTATCTAGAAGTGCAGTATACTCGAGTATACTGCACTTCTAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-462s21c1
Sequence:CCGGACGTAACTTGATGATCGATATCTCGAGATATCGATCATCAAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-1320s21c1
Sequence:CCGGCGCAGACACAGCTATAATCAACTCGAGTTGATTATAGCTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-921s21c1
Sequence:CCGGCCTGTTCATCAATAACCTAAACTCGAGTTTAGGTTATTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207675
VALIDATED
CADM1 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-1320s1c1
Sequence:CCGGCGCAGACACAGCTATAATCAACTCGAGTTGATTATAGCTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207675.2-460s1c1
Sequence:CCGGCCACGTAACTTGATGATCGATCTCGAGATCGATCATCAAGTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-734s1c1
Sequence:CCGGGCTATCTAGAAGTGCAGTATACTCGAGTATACTGCACTTCTAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-921s1c1
Sequence:CCGGCCTGTTCATCAATAACCTAAACTCGAGTTTAGGTTATTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-3423s1c1
Sequence:CCGGCGGACTGGTTTGTAAAGGAAACTCGAGTTTCCTTTACAAACCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207675.2-1709s21c1
Sequence:CCGGGGATTTGGTTTCGGTAGATTGCTCGAGCAATCTACCGAAACCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-734s21c1
Sequence:CCGGGCTATCTAGAAGTGCAGTATACTCGAGTATACTGCACTTCTAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-462s21c1
Sequence:CCGGACGTAACTTGATGATCGATATCTCGAGATATCGATCATCAAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-1320s21c1
Sequence:CCGGCGCAGACACAGCTATAATCAACTCGAGTTGATTATAGCTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-921s21c1
Sequence:CCGGCCTGTTCATCAATAACCTAAACTCGAGTTTAGGTTATTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207675
VALIDATED
CADM1 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-1320s1c1
Sequence:CCGGCGCAGACACAGCTATAATCAACTCGAGTTGATTATAGCTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207675.2-460s1c1
Sequence:CCGGCCACGTAACTTGATGATCGATCTCGAGATCGATCATCAAGTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-734s1c1
Sequence:CCGGGCTATCTAGAAGTGCAGTATACTCGAGTATACTGCACTTCTAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-921s1c1
Sequence:CCGGCCTGTTCATCAATAACCTAAACTCGAGTTTAGGTTATTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207675.2-3423s1c1
Sequence:CCGGCGGACTGGTTTGTAAAGGAAACTCGAGTTTCCTTTACAAACCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207675.2-1709s21c1
Sequence:CCGGGGATTTGGTTTCGGTAGATTGCTCGAGCAATCTACCGAAACCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-734s21c1
Sequence:CCGGGCTATCTAGAAGTGCAGTATACTCGAGTATACTGCACTTCTAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-462s21c1
Sequence:CCGGACGTAACTTGATGATCGATATCTCGAGATATCGATCATCAAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-1320s21c1
Sequence:CCGGCGCAGACACAGCTATAATCAACTCGAGTTGATTATAGCTGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207675.2-921s21c1
Sequence:CCGGCCTGTTCATCAATAACCTAAACTCGAGTTTAGGTTATTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014333
VALIDATED
CADM1 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014333.2-2468s1c1
Sequence:CCGGGCCTGCATGTACTGTATATTACTCGAGTAATATACAGTACATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014333.2-1202s1c1
Sequence:CCGGCCAGACATAAAGGTACATACTCTCGAGAGTATGTACCTTTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014333.2-974s1c1
Sequence:CCGGCGGATTATATGCTGTATGTATCTCGAGATACATACAGCATATAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014333.2-745s1c1
Sequence:CCGGCAGATGACTTATCCTCTACAACTCGAGTTGTAGAGGATAAGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1328s21c1
Sequence:CCGGCCAGACATAAAGGTACATACTCTCGAGAGTATGTACCTTTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-871s21c1
Sequence:CCGGCAGATGACTTATCCTCTACAACTCGAGTTGTAGAGGATAAGTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014333.3-1482s21c1
Sequence:CCGGGTGTCCAACTGGCCCTATTTACTCGAGTAAATAGGGCCAGTTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1089s21c1
Sequence:CCGGGAAAGCTCACTCGGATTATATCTCGAGATATAATCCGAGTGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1383s21c1
Sequence:CCGGAGACGCAGACACAGCTATAATCTCGAGATTATAGCTGTGTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014333
VALIDATED
CADM1 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014333.2-2468s1c1
Sequence:CCGGGCCTGCATGTACTGTATATTACTCGAGTAATATACAGTACATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014333.2-1202s1c1
Sequence:CCGGCCAGACATAAAGGTACATACTCTCGAGAGTATGTACCTTTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014333.2-974s1c1
Sequence:CCGGCGGATTATATGCTGTATGTATCTCGAGATACATACAGCATATAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014333.2-745s1c1
Sequence:CCGGCAGATGACTTATCCTCTACAACTCGAGTTGTAGAGGATAAGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1328s21c1
Sequence:CCGGCCAGACATAAAGGTACATACTCTCGAGAGTATGTACCTTTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-871s21c1
Sequence:CCGGCAGATGACTTATCCTCTACAACTCGAGTTGTAGAGGATAAGTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014333.3-1482s21c1
Sequence:CCGGGTGTCCAACTGGCCCTATTTACTCGAGTAAATAGGGCCAGTTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1089s21c1
Sequence:CCGGGAAAGCTCACTCGGATTATATCTCGAGATATAATCCGAGTGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1383s21c1
Sequence:CCGGAGACGCAGACACAGCTATAATCTCGAGATTATAGCTGTGTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014333
VALIDATED
CADM1 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014333.2-2468s1c1
Sequence:CCGGGCCTGCATGTACTGTATATTACTCGAGTAATATACAGTACATGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014333.2-1202s1c1
Sequence:CCGGCCAGACATAAAGGTACATACTCTCGAGAGTATGTACCTTTATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014333.2-974s1c1
Sequence:CCGGCGGATTATATGCTGTATGTATCTCGAGATACATACAGCATATAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014333.2-745s1c1
Sequence:CCGGCAGATGACTTATCCTCTACAACTCGAGTTGTAGAGGATAAGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1328s21c1
Sequence:CCGGCCAGACATAAAGGTACATACTCTCGAGAGTATGTACCTTTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-871s21c1
Sequence:CCGGCAGATGACTTATCCTCTACAACTCGAGTTGTAGAGGATAAGTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014333.3-1482s21c1
Sequence:CCGGGTGTCCAACTGGCCCTATTTACTCGAGTAAATAGGGCCAGTTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1089s21c1
Sequence:CCGGGAAAGCTCACTCGGATTATATCTCGAGATATAATCCGAGTGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014333.3-1383s21c1
Sequence:CCGGAGACGCAGACACAGCTATAATCTCGAGATTATAGCTGTGTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks