EMAIL THIS PAGE TO A FRIEND

CADM2

cell adhesion molecule 2

163 Gene Product Result for
Synonyms: IGSF4D NECL3 Necl-3 SynCAM 2 synCAM2
UniProtKB ID: Q8N3J6, Q3KQY9, Q658Q7, Q8IZP8
Gene ID:
Human(253559) Summary: This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(239857) cell adhesion molecule 2
Rat(360687) cell adhesion molecule 2
chicken(418463) cell adhesion molecule 2
dog(487680) cell adhesion molecule 2
domestic cat(101098567) cell adhesion molecule 2
cow(517759) cell adhesion molecule 2
Horse(100069765) cell adhesion molecule 2
sheep(101120371) cell adhesion molecule 2
Domestic Rabbit(100340168) cell adhesion molecule 2
domestic guinea pig(100734249) cell adhesion molecule 2
naked mole-rat(101715396) cell adhesion molecule 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA010024 Anti-CADM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501053 Anti-CADM2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB2900689 Anti-CADM2 antibody produced in rabbit affinity isolated antibody monkey, human, rat, mouse, rabbit, chicken, bovine, pig, horse, hamster
immunohistochemistry pricing
SAB2900737 Anti-CADM2 antibody produced in rabbit affinity isolated antibody bovine, rat, hamster, pig, mouse, monkey, horse, dog, human, rabbit, Xenopus, guinea pig
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123181 MISSION® esiRNA esiRNA human CADM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153184 Rosetta Predictions human pricing
NM_001047102 Rosetta Predictions rat pricing
NM_178721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246480 predicted 1170
2 SASI_Hs01_00246481 predicted 1057
3 SASI_Hs01_00246482 predicted 216
4 SASI_Hs01_00246483 predicted 785
5 SASI_Hs01_00246484 predicted 1072
6 SASI_Hs01_00246485 predicted 392
7 SASI_Hs01_00246486 predicted 1234
8 SASI_Hs01_00246487 predicted 461
9 SASI_Hs01_00246488 predicted 405
10 SASI_Hs01_00246489 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205954 predicted 720
2 SASI_Rn02_00205955 predicted 928
3 SASI_Rn02_00205956 predicted 292
4 SASI_Rn02_00205957 predicted 661
5 SASI_Rn02_00205958 predicted 723
6 SASI_Rn02_00205959 predicted 729
7 SASI_Rn02_00205960 predicted 439
8 SASI_Rn02_00205961 predicted 891
9 SASI_Rn02_00205962 predicted 440
10 SASI_Rn02_00205963 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154639 predicted 1541
2 SASI_Mm01_00154640 predicted 1343
3 SASI_Mm01_00154641 predicted 1457
4 SASI_Mm01_00154642 predicted 1210
5 SASI_Mm01_00154643 predicted 887
6 SASI_Mm01_00154644 predicted 767
7 SASI_Mm01_00154645 predicted 1598
8 SASI_Mm02_00349238 predicted 1139
9 SASI_Mm01_00154646 predicted 1569
10 SASI_Mm01_00154647 predicted 1127
11 SASI_Mm01_00154648 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153184
CADM2 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1397s21c1
Sequence:CCGGCATCGTCTGCTACCCTTATTACTCGAGTAATAAGGGTAGCAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1590s21c1
Sequence:CCGGATCATCTCCTTGGATCATTATCTCGAGATAATGATCCAAGGAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1763s21c1
Sequence:CCGGGGTTAGAGGTTTACAATTAATCTCGAGATTAATTGTAAACCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1865s1c1
Sequence:CCGGCCAAGTCAATGCTGAAGAGAACTCGAGTTCTCTTCAGCATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1429s1c1
Sequence:CCGGGTAGGGAGCTAAACATTCTTTCTCGAGAAAGAATGTTTAGCTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1740s1c1
Sequence:CCGGCTGTGTTCTATCTTTCTGCTTCTCGAGAAGCAGAAAGATAGAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153184.1-668s1c1
Sequence:CCGGGCAGTTTCCACTAACACAGAACTCGAGTTCTGTGTTAGTGGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1773s1c1
Sequence:CCGGGCAAGGCATAAAGGAACGTATCTCGAGATACGTTCCTTTATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1694s1c1
Sequence:CCGGCCATGCTCTCATAGGAGGAATCTCGAGATTCCTCCTATGAGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153184.1-816s1c1
Sequence:CCGGGACAATAGGATCGAGCTGGTTCTCGAGAACCAGCTCGATCCTATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153184
CADM2 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1397s21c1
Sequence:CCGGCATCGTCTGCTACCCTTATTACTCGAGTAATAAGGGTAGCAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1590s21c1
Sequence:CCGGATCATCTCCTTGGATCATTATCTCGAGATAATGATCCAAGGAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1763s21c1
Sequence:CCGGGGTTAGAGGTTTACAATTAATCTCGAGATTAATTGTAAACCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1865s1c1
Sequence:CCGGCCAAGTCAATGCTGAAGAGAACTCGAGTTCTCTTCAGCATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1429s1c1
Sequence:CCGGGTAGGGAGCTAAACATTCTTTCTCGAGAAAGAATGTTTAGCTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1740s1c1
Sequence:CCGGCTGTGTTCTATCTTTCTGCTTCTCGAGAAGCAGAAAGATAGAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153184.1-668s1c1
Sequence:CCGGGCAGTTTCCACTAACACAGAACTCGAGTTCTGTGTTAGTGGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1773s1c1
Sequence:CCGGGCAAGGCATAAAGGAACGTATCTCGAGATACGTTCCTTTATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1694s1c1
Sequence:CCGGCCATGCTCTCATAGGAGGAATCTCGAGATTCCTCCTATGAGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153184.1-816s1c1
Sequence:CCGGGACAATAGGATCGAGCTGGTTCTCGAGAACCAGCTCGATCCTATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153184
CADM2 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1397s21c1
Sequence:CCGGCATCGTCTGCTACCCTTATTACTCGAGTAATAAGGGTAGCAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1590s21c1
Sequence:CCGGATCATCTCCTTGGATCATTATCTCGAGATAATGATCCAAGGAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153184.3-1763s21c1
Sequence:CCGGGGTTAGAGGTTTACAATTAATCTCGAGATTAATTGTAAACCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1865s1c1
Sequence:CCGGCCAAGTCAATGCTGAAGAGAACTCGAGTTCTCTTCAGCATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1429s1c1
Sequence:CCGGGTAGGGAGCTAAACATTCTTTCTCGAGAAAGAATGTTTAGCTCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1740s1c1
Sequence:CCGGCTGTGTTCTATCTTTCTGCTTCTCGAGAAGCAGAAAGATAGAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153184.1-668s1c1
Sequence:CCGGGCAGTTTCCACTAACACAGAACTCGAGTTCTGTGTTAGTGGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1773s1c1
Sequence:CCGGGCAAGGCATAAAGGAACGTATCTCGAGATACGTTCCTTTATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153184.1-1694s1c1
Sequence:CCGGCCATGCTCTCATAGGAGGAATCTCGAGATTCCTCCTATGAGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153184.1-816s1c1
Sequence:CCGGGACAATAGGATCGAGCTGGTTCTCGAGAACCAGCTCGATCCTATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178721
CADM2 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178721.4-1437s21c1
Sequence:CCGGACGTTGACCTGTGAATCTAAACTCGAGTTTAGATTCACAGGTCAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178721.4-1253s21c1
Sequence:CCGGCGTTAGCAGCACGCTGGATTTCTCGAGAAATCCAGCGTGCTGCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178721.2-2059s1c1
Sequence:CCGGCCATCCATAATGCAGGACATTCTCGAGAATGTCCTGCATTATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1700s1c1
Sequence:CCGGTGTTACACTGTGCTCCATATTCTCGAGAATATGGAGCACAGTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1602s1c1
Sequence:CCGGGCCGAGTATGTCCTCATTGTTCTCGAGAACAATGAGGACATACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1146s1c1
Sequence:CCGGGCTGATATAAGATGGTTCAAACTCGAGTTTGAACCATCTTATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1332s1c1
Sequence:CCGGGCCATGCAGGTGCTAGAAATTCTCGAGAATTTCTAGCACCTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178721
CADM2 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178721.4-1437s21c1
Sequence:CCGGACGTTGACCTGTGAATCTAAACTCGAGTTTAGATTCACAGGTCAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178721.4-1253s21c1
Sequence:CCGGCGTTAGCAGCACGCTGGATTTCTCGAGAAATCCAGCGTGCTGCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178721.2-2059s1c1
Sequence:CCGGCCATCCATAATGCAGGACATTCTCGAGAATGTCCTGCATTATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1700s1c1
Sequence:CCGGTGTTACACTGTGCTCCATATTCTCGAGAATATGGAGCACAGTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1602s1c1
Sequence:CCGGGCCGAGTATGTCCTCATTGTTCTCGAGAACAATGAGGACATACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1146s1c1
Sequence:CCGGGCTGATATAAGATGGTTCAAACTCGAGTTTGAACCATCTTATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1332s1c1
Sequence:CCGGGCCATGCAGGTGCTAGAAATTCTCGAGAATTTCTAGCACCTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178721
CADM2 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178721.4-1437s21c1
Sequence:CCGGACGTTGACCTGTGAATCTAAACTCGAGTTTAGATTCACAGGTCAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178721.4-1253s21c1
Sequence:CCGGCGTTAGCAGCACGCTGGATTTCTCGAGAAATCCAGCGTGCTGCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178721.2-2059s1c1
Sequence:CCGGCCATCCATAATGCAGGACATTCTCGAGAATGTCCTGCATTATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1700s1c1
Sequence:CCGGTGTTACACTGTGCTCCATATTCTCGAGAATATGGAGCACAGTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1602s1c1
Sequence:CCGGGCCGAGTATGTCCTCATTGTTCTCGAGAACAATGAGGACATACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1146s1c1
Sequence:CCGGGCTGATATAAGATGGTTCAAACTCGAGTTTGAACCATCTTATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178721.2-1332s1c1
Sequence:CCGGGCCATGCAGGTGCTAGAAATTCTCGAGAATTTCTAGCACCTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks