EMAIL THIS PAGE TO A FRIEND

CADM3

cell adhesion molecule 3

123 Gene Product Result for
Synonyms: BIgR IGSF4B NECL1 Necl-1 TSLL1 synCAM3
UniProtKB ID: Q8N126, Q8IZQ9, Q9NVJ5, Q9UJP1
Gene ID:
Human(57863) Summary: IGSF4B is a brain-specific protein related to the calcium-independent cell-cell adhesion molecules known as nectins (see PVRL3; MIM 607147) (Kakunaga et al., 2005 [PubMed 15741237]
Mouse(94332) cell adhesion molecule 3
Rat(360882) cell adhesion molecule 3
Zebrafish(692273) cell adhesion molecule 3
chicken(772356) cell adhesion molecule 3
dog(610435) cell adhesion molecule 3
domestic cat(101094821) cell adhesion molecule 3
Horse(100053379) cell adhesion molecule 3
cow(531178) cell adhesion molecule 3
naked mole-rat(101703080) cell adhesion molecule 3
domestic guinea pig(100724458) cell adhesion molecule 3
sheep(101121565) cell adhesion molecule 3
Domestic Rabbit(100350338) cell adhesion molecule 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1513 Human IGSF4B ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021189 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127173 Rosetta Predictions human pricing
NM_021189 Rosetta Predictions human pricing
NM_001047103 Rosetta Predictions rat pricing
NM_053199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328527 predicted 768
2 SASI_Hs02_00328528 predicted 831
3 SASI_Hs02_00328529 predicted 1070
4 SASI_Hs02_00328530 predicted 673
5 SASI_Hs02_00328531 predicted 1219
6 SASI_Hs02_00328532 predicted 673
7 SASI_Hs02_00328533 predicted 492
8 SASI_Hs02_00328534 predicted 537
9 SASI_Hs02_00328535 predicted 508
10 SASI_Hs02_00328536 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354759 predicted 907
2 SASI_Hs02_00354760 predicted 973
3 SASI_Hs01_00196485 predicted 1209
4 SASI_Hs01_00196486 predicted 808
5 SASI_Hs01_00196487 predicted 1353
6 SASI_Hs02_00354761 predicted 816
7 SASI_Hs02_00354762 predicted 637
8 SASI_Hs02_00354763 predicted 682
9 SASI_Hs02_00354764 predicted 638
10 SASI_Hs02_00354765 predicted 793
11 SASI_Hs01_00196481 predicted 1162
12 SASI_Hs01_00196482 predicted 864
13 SASI_Hs01_00196483 predicted 871
14 SASI_Hs01_00196484 predicted 552
15 SASI_Hs01_00196488 predicted 642
16 SASI_Hs01_00196489 predicted 902
17 SASI_Hs01_00196490 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205964 predicted 629
2 SASI_Rn02_00205965 predicted 897
3 SASI_Rn02_00205966 predicted 885
4 SASI_Rn02_00205967 predicted 521
5 SASI_Rn02_00205968 predicted 223
6 SASI_Rn02_00205969 predicted 430
7 SASI_Rn02_00205970 predicted 316
8 SASI_Rn02_00205971 predicted 618
9 SASI_Rn02_00205972 predicted 829
10 SASI_Rn02_00205973 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116497 predicted 830
2 SASI_Mm01_00116498 predicted 638
3 SASI_Mm01_00116499 predicted 488
4 SASI_Mm01_00116500 predicted 293
5 SASI_Mm01_00116501 predicted 823
6 SASI_Mm01_00116502 predicted 600
7 SASI_Mm01_00116503 predicted 583
8 SASI_Mm01_00116504 predicted 257
9 SASI_Mm01_00116505 predicted 1119
10 SASI_Mm01_00116506 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021189
CADM3 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-681s1c1
Sequence:CCGGCCACCCTAAACTGTCAGTCTTCTCGAGAAGACTGACAGTTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-467s1c1
Sequence:CCGGGCCCTTCGAGATAATCGAATTCTCGAGAATTCGATTATCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-1295s1c1
Sequence:CCGGCACTACTTGATCCGGCACAAACTCGAGTTTGTGCCGGATCAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-770s1c1
Sequence:CCGGCGCATACAGGAAGATCCCAATCTCGAGATTGGGATCTTCCTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-556s1c1
Sequence:CCGGCGAGTACACCTGCTCAATCTTCTCGAGAAGATTGAGCAGGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021189.3-912s21c1
Sequence:CCGGGTGAACCATGAATCTCTAAAGCTCGAGCTTTAGAGATTCATGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021189.3-1452s21c1
Sequence:CCGGGACGACAAGAAGGAATATTTCCTCGAGGAAATATTCCTTCTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021189
CADM3 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-681s1c1
Sequence:CCGGCCACCCTAAACTGTCAGTCTTCTCGAGAAGACTGACAGTTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-467s1c1
Sequence:CCGGGCCCTTCGAGATAATCGAATTCTCGAGAATTCGATTATCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-1295s1c1
Sequence:CCGGCACTACTTGATCCGGCACAAACTCGAGTTTGTGCCGGATCAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-770s1c1
Sequence:CCGGCGCATACAGGAAGATCCCAATCTCGAGATTGGGATCTTCCTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-556s1c1
Sequence:CCGGCGAGTACACCTGCTCAATCTTCTCGAGAAGATTGAGCAGGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021189.3-912s21c1
Sequence:CCGGGTGAACCATGAATCTCTAAAGCTCGAGCTTTAGAGATTCATGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021189.3-1452s21c1
Sequence:CCGGGACGACAAGAAGGAATATTTCCTCGAGGAAATATTCCTTCTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021189
CADM3 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-681s1c1
Sequence:CCGGCCACCCTAAACTGTCAGTCTTCTCGAGAAGACTGACAGTTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-467s1c1
Sequence:CCGGGCCCTTCGAGATAATCGAATTCTCGAGAATTCGATTATCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-1295s1c1
Sequence:CCGGCACTACTTGATCCGGCACAAACTCGAGTTTGTGCCGGATCAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-770s1c1
Sequence:CCGGCGCATACAGGAAGATCCCAATCTCGAGATTGGGATCTTCCTGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021189.2-556s1c1
Sequence:CCGGCGAGTACACCTGCTCAATCTTCTCGAGAAGATTGAGCAGGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021189.3-912s21c1
Sequence:CCGGGTGAACCATGAATCTCTAAAGCTCGAGCTTTAGAGATTCATGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021189.3-1452s21c1
Sequence:CCGGGACGACAAGAAGGAATATTTCCTCGAGGAAATATTCCTTCTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053199
CADM3 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053199.3-3903s1c1
Sequence:CCGGCCCTCCTGATACACCTGAAATCTCGAGATTTCAGGTGTATCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-1252s1c1
Sequence:CCGGCACTATTTGATCCGGCACAAACTCGAGTTTGTGCCGGATCAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-266s1c1
Sequence:CCGGCCAATCTTTCCCAGGACGATACTCGAGTATCGTCCTGGGAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-424s1c1
Sequence:CCGGGCCCTTCGAGATAATCGGATTCTCGAGAATCCGATTATCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-638s1c1
Sequence:CCGGCCACTCTAAATTGTCAGTCTTCTCGAGAAGACTGACAATTTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053199
CADM3 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053199.3-3903s1c1
Sequence:CCGGCCCTCCTGATACACCTGAAATCTCGAGATTTCAGGTGTATCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-1252s1c1
Sequence:CCGGCACTATTTGATCCGGCACAAACTCGAGTTTGTGCCGGATCAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-266s1c1
Sequence:CCGGCCAATCTTTCCCAGGACGATACTCGAGTATCGTCCTGGGAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-424s1c1
Sequence:CCGGGCCCTTCGAGATAATCGGATTCTCGAGAATCCGATTATCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-638s1c1
Sequence:CCGGCCACTCTAAATTGTCAGTCTTCTCGAGAAGACTGACAATTTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053199
CADM3 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053199.3-3903s1c1
Sequence:CCGGCCCTCCTGATACACCTGAAATCTCGAGATTTCAGGTGTATCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-1252s1c1
Sequence:CCGGCACTATTTGATCCGGCACAAACTCGAGTTTGTGCCGGATCAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-266s1c1
Sequence:CCGGCCAATCTTTCCCAGGACGATACTCGAGTATCGTCCTGGGAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-424s1c1
Sequence:CCGGGCCCTTCGAGATAATCGGATTCTCGAGAATCCGATTATCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053199.3-638s1c1
Sequence:CCGGCCACTCTAAATTGTCAGTCTTCTCGAGAAGACTGACAATTTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks