EMAIL THIS PAGE TO A FRIEND

CADM4

cell adhesion molecule 4

146 Gene Product Result for
Synonyms: IGSF4C NECL4 Necl-4 TSLL2 synCAM4
UniProtKB ID: Q8NFZ8, B2R7L5, Q9Y4A4
Gene ID:
Mouse(260299) cell adhesion molecule 4
Rat(365216) cell adhesion molecule 4
sheep(101107547) cell adhesion molecule 4
Domestic Rabbit(100351370) cell adhesion molecule 4
domestic guinea pig(100714919) cell adhesion molecule 4
naked mole-rat(101705556) cell adhesion molecule 4
Zebrafish(492787) cell adhesion molecule 4
dog(484465) cell adhesion molecule 4
Horse(100070257) cell adhesion molecule 4
cow(523277) cell adhesion molecule 4
domestic cat(101101524) cell adhesion molecule 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1514 Human IGSF4C ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020381 MISSION® esiRNA esiRNA human CADM4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145296 Rosetta Predictions human pricing
NM_001047107 Rosetta Predictions rat pricing
XM_344870 Rosetta Predictions rat pricing
NM_153112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365186 predicted 764
2 SASI_Hs01_00118777 predicted 993
3 SASI_Hs01_00118779 predicted 260
4 SASI_Hs02_00365187 predicted 1274
5 SASI_Hs01_00118780 predicted 810
6 SASI_Hs01_00118781 predicted 382
7 SASI_Hs01_00118782 predicted 1036
8 SASI_Hs01_00118783 predicted 1280
9 SASI_Hs01_00118784 predicted 907
10 SASI_Hs01_00118785 predicted 596
11 SASI_Hs01_00118776 predicted 346
12 SASI_Hs01_00118778 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205985 predicted 208
2 SASI_Rn02_00205986 predicted 333
3 SASI_Rn02_00205987 predicted 357
4 SASI_Rn02_00205988 predicted 571
5 SASI_Rn02_00205989 predicted 346
6 SASI_Rn02_00205990 predicted 900
7 SASI_Rn02_00205991 predicted 460
8 SASI_Rn02_00205992 predicted 901
9 SASI_Rn02_00205993 predicted 899
10 SASI_Rn02_00205994 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143906 predicted 845
2 SASI_Rn01_00143907 predicted 1182
3 SASI_Rn01_00143908 predicted 863
4 SASI_Rn01_00143909 predicted 992
5 SASI_Rn01_00143910 predicted 1080
6 SASI_Rn01_00143911 predicted 1406
7 SASI_Rn01_00143912 predicted 1035
8 SASI_Rn01_00143913 predicted 970
9 SASI_Rn01_00143914 predicted 1418
10 SASI_Rn01_00143915 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342971 predicted 1025
2 SASI_Mm01_00047390 predicted 444
3 SASI_Mm01_00047391 predicted 1258
4 SASI_Mm01_00047392 predicted 1060
5 SASI_Mm01_00047393 predicted 411
6 SASI_Mm01_00047394 predicted 749
7 SASI_Mm02_00342972 predicted 1265
8 SASI_Mm01_00047395 predicted 557
9 SASI_Mm01_00047396 predicted 427
10 SASI_Mm01_00047398 predicted 638
11 SASI_Mm01_00047397 predicted 1055
12 SASI_Mm01_00047399 predicted 1357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145296
CADM4 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-1004s21c1
Sequence:CCGGACGTCGGTTCCCTATGCCATTCTCGAGAATGGCATAGGGAACCGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-392s21c1
Sequence:CCGGATTGCCACGCTCACGGTACTACTCGAGTAGTACCGTGAGCGTGGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-588s21c1
Sequence:CCGGTGGCAAGCACAGTACGGTTTCCTCGAGGAAACCGTACTGTGCTTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-202s1c1
Sequence:CCGGGTCCATAGTTGTCATCCAGAACTCGAGTTCTGGATGACAACTATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-191s1c1
Sequence:CCGGCAGTATGATGGGTCCATAGTTCTCGAGAACTATGGACCCATCATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-188s1c1
Sequence:CCGGCACCAGTATGATGGGTCCATACTCGAGTATGGACCCATCATACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-628s1c1
Sequence:CCGGCGGTGGTATCATCATCTGTGACTCGAGTCACAGATGATGATACCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-955s1c1
Sequence:CCGGGCTCTACGTACTTGTGGTCTACTCGAGTAGACCACAAGTACGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145296.1-1627s1c1
Sequence:CCGGCCAGCCATTGTAAGAGTTCCACTCGAGTGGAACTCTTACAATGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145296
CADM4 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-1004s21c1
Sequence:CCGGACGTCGGTTCCCTATGCCATTCTCGAGAATGGCATAGGGAACCGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-392s21c1
Sequence:CCGGATTGCCACGCTCACGGTACTACTCGAGTAGTACCGTGAGCGTGGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-588s21c1
Sequence:CCGGTGGCAAGCACAGTACGGTTTCCTCGAGGAAACCGTACTGTGCTTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-202s1c1
Sequence:CCGGGTCCATAGTTGTCATCCAGAACTCGAGTTCTGGATGACAACTATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-191s1c1
Sequence:CCGGCAGTATGATGGGTCCATAGTTCTCGAGAACTATGGACCCATCATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-188s1c1
Sequence:CCGGCACCAGTATGATGGGTCCATACTCGAGTATGGACCCATCATACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-628s1c1
Sequence:CCGGCGGTGGTATCATCATCTGTGACTCGAGTCACAGATGATGATACCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-955s1c1
Sequence:CCGGGCTCTACGTACTTGTGGTCTACTCGAGTAGACCACAAGTACGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145296.1-1627s1c1
Sequence:CCGGCCAGCCATTGTAAGAGTTCCACTCGAGTGGAACTCTTACAATGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145296
CADM4 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-1004s21c1
Sequence:CCGGACGTCGGTTCCCTATGCCATTCTCGAGAATGGCATAGGGAACCGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-392s21c1
Sequence:CCGGATTGCCACGCTCACGGTACTACTCGAGTAGTACCGTGAGCGTGGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145296.1-588s21c1
Sequence:CCGGTGGCAAGCACAGTACGGTTTCCTCGAGGAAACCGTACTGTGCTTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-202s1c1
Sequence:CCGGGTCCATAGTTGTCATCCAGAACTCGAGTTCTGGATGACAACTATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-191s1c1
Sequence:CCGGCAGTATGATGGGTCCATAGTTCTCGAGAACTATGGACCCATCATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-188s1c1
Sequence:CCGGCACCAGTATGATGGGTCCATACTCGAGTATGGACCCATCATACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-628s1c1
Sequence:CCGGCGGTGGTATCATCATCTGTGACTCGAGTCACAGATGATGATACCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145296.1-955s1c1
Sequence:CCGGGCTCTACGTACTTGTGGTCTACTCGAGTAGACCACAAGTACGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145296.1-1627s1c1
Sequence:CCGGCCAGCCATTGTAAGAGTTCCACTCGAGTGGAACTCTTACAATGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153112
CADM4 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-435s21c1
Sequence:CCGGTCTTAGTGGCTCCGGAGAATCCTCGAGGATTCTCCGGAGCCACTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-555s21c1
Sequence:CCGGGGGATCGCAAGGAGTTGAAAGCTCGAGCTTTCAACTCCTTGCGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-225s21c1
Sequence:CCGGATGGGTCCATAGTCGTCATTCCTCGAGGAATGACGACTATGGACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-723s21c1
Sequence:CCGGACGTGCTGGATGTGCAGTATTCTCGAGAATACTGCACATCCAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153112.3-1459s21c1
Sequence:CCGGCAGTCCTGGGACGGGTAATAACTCGAGTTATTACCCGTCCCAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153112.1-1512s1c1
Sequence:CCGGGAAGGGAAACACAGATTTCTTCTCGAGAAGAAATCTGTGTTTCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153112
CADM4 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-435s21c1
Sequence:CCGGTCTTAGTGGCTCCGGAGAATCCTCGAGGATTCTCCGGAGCCACTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-555s21c1
Sequence:CCGGGGGATCGCAAGGAGTTGAAAGCTCGAGCTTTCAACTCCTTGCGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-225s21c1
Sequence:CCGGATGGGTCCATAGTCGTCATTCCTCGAGGAATGACGACTATGGACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-723s21c1
Sequence:CCGGACGTGCTGGATGTGCAGTATTCTCGAGAATACTGCACATCCAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153112.3-1459s21c1
Sequence:CCGGCAGTCCTGGGACGGGTAATAACTCGAGTTATTACCCGTCCCAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153112.1-1512s1c1
Sequence:CCGGGAAGGGAAACACAGATTTCTTCTCGAGAAGAAATCTGTGTTTCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153112
CADM4 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-435s21c1
Sequence:CCGGTCTTAGTGGCTCCGGAGAATCCTCGAGGATTCTCCGGAGCCACTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-555s21c1
Sequence:CCGGGGGATCGCAAGGAGTTGAAAGCTCGAGCTTTCAACTCCTTGCGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-225s21c1
Sequence:CCGGATGGGTCCATAGTCGTCATTCCTCGAGGAATGACGACTATGGACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153112.3-723s21c1
Sequence:CCGGACGTGCTGGATGTGCAGTATTCTCGAGAATACTGCACATCCAGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153112.3-1459s21c1
Sequence:CCGGCAGTCCTGGGACGGGTAATAACTCGAGTTATTACCCGTCCCAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153112.1-1512s1c1
Sequence:CCGGGAAGGGAAACACAGATTTCTTCTCGAGAAGAAATCTGTGTTTCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)