EMAIL THIS PAGE TO A FRIEND

CADPS2

Ca++-dependent secretion activator 2

Gene ID:
Human(93664) Summary: This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
Mouse(320405) Ca2+-dependent activator protein for secretion 2
Rat(312166) Ca++-dependent secretion activator 2
sheep(101104231) Ca++-dependent secretion activator 2
domestic guinea pig(100735956) Ca++-dependent secretion activator 2
naked mole-rat(101702457) Ca++-dependent secretion activator 2
Zebrafish(407617) Ca2+-dependent activator protein for secretion 2
chicken(417756) Ca++-dependent secretion activator 2
dog(475304) Ca++-dependent secretion activator 2
Horse(100056300) Ca++-dependent secretion activator 2
cow(519444) Ca++-dependent secretion activator 2
domestic cat(101092015) Ca++-dependent secretion activator 2
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056398 Anti-CADPS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
PRS4565 Anti-CAPS2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009571 Rosetta Predictions human pricing
NM_017954 Rosetta Predictions human pricing
XM_001060172 Rosetta Predictions rat pricing
XM_231528 Rosetta Predictions rat pricing
NM_153163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305642 predicted 3667
2 SASI_Hs01_00109582 predicted 3663
3 SASI_Hs01_00109583 predicted 1090
4 SASI_Hs01_00109585 predicted 1695
5 SASI_Hs01_00109586 predicted 726
6 SASI_Hs01_00109587 predicted 1253
7 SASI_Hs01_00109588 predicted 1134
8 SASI_Hs01_00109589 predicted 1780
9 SASI_Hs01_00109590 predicted 1613
10 SASI_Hs02_00305643 predicted 1724
11 SASI_Hs01_00109584 predicted 372
12 SASI_Hs01_00109591 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350985 predicted 3799
2 SASI_Hs01_00057233 predicted 3786
3 SASI_Hs01_00057234 predicted 1098
4 SASI_Hs01_00057236 predicted 1693
5 SASI_Hs01_00057237 predicted 723
6 SASI_Hs01_00057238 predicted 1250
7 SASI_Hs01_00057239 predicted 1139
8 SASI_Hs01_00057240 predicted 1775
9 SASI_Hs01_00057241 predicted 1618
10 SASI_Hs02_00350986 predicted 1724
11 SASI_Hs01_00057235 predicted 365
12 SASI_Hs01_00057242 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295591 predicted 620
2 SASI_Rn02_00295592 predicted 2688
3 SASI_Rn02_00295593 predicted 1801
4 SASI_Rn02_00295594 predicted 3703
5 SASI_Rn02_00295595 predicted 2126
6 SASI_Rn02_00295596 predicted 3020
7 SASI_Rn02_00295597 predicted 977
8 SASI_Rn02_00295598 predicted 884
9 SASI_Rn02_00295599 predicted 1004
10 SASI_Rn02_00295600 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386821 predicted 619
2 SASI_Rn02_00386822 predicted 2690
3 SASI_Rn02_00386823 predicted 1803
4 SASI_Rn02_00386824 predicted 3704
5 SASI_Rn02_00386825 predicted 2124
6 SASI_Rn02_00386826 predicted 3024
7 SASI_Rn02_00386827 predicted 974
8 SASI_Rn02_00386828 predicted 889
9 SASI_Rn02_00386829 predicted 1002
10 SASI_Rn02_00386830 predicted 3431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136225 predicted 1510
2 SASI_Mm01_00136226 predicted 895
3 SASI_Mm01_00136227 predicted 2581
4 SASI_Mm01_00136228 predicted 1689
5 SASI_Mm02_00343063 predicted 3361
6 SASI_Mm01_00136229 predicted 3950
7 SASI_Mm01_00136231 predicted 1734
8 SASI_Mm01_00136232 predicted 2013
9 SASI_Mm01_00136233 predicted 3843
10 SASI_Mm01_00136234 predicted 970
11 SASI_Mm01_00136230 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017954
CADPS2 MISSION shRNA Bacterial Glycerol Stock
Ca++-dependent secretion activator 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-454s1c1
Sequence:CCGGGCAACGCAGTTCGGAGTTATTCTCGAGAATAACTCCGAACTGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-3078s1c1
Sequence:CCGGGCACTGCAAATGTTTGTCTTTCTCGAGAAAGACAAACATTTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1041s1c1
Sequence:CCGGCGTTCACAGAACTCTGCATTTCTCGAGAAATGCAGAGTTCTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1374s1c1
Sequence:CCGGCCAACTTCTAATAGCTCCAAACTCGAGTTTGGAGCTATTAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-3201s1c1
Sequence:CCGGGCATTTGAACTCAAGCTACAACTCGAGTTGTAGCTTGAGTTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-2165s1c1
Sequence:CCGGGCTCCATTACAGCTTTGCATTCTCGAGAATGCAAAGCTGTAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1398s1c1
Sequence:CCGGGCTGAATTACACCGAATGGTACTCGAGTACCATTCGGTGTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-383s1c1
Sequence:CCGGGCAGTTACTGAAAGAACGGTTCTCGAGAACCGTTCTTTCAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017954.10-2455s21c1
Sequence:CCGGATGAGTACTGTGCCCGTTATGCTCGAGCATAACGGGCACAGTACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017954.10-3939s21c1
Sequence:CCGGGATCTGGCAGACACCTATATTCTCGAGAATATAGGTGTCTGCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017954
CADPS2 MISSION shRNA shRNA Plasmid DNA
Ca++-dependent secretion activator 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-454s1c1
Sequence:CCGGGCAACGCAGTTCGGAGTTATTCTCGAGAATAACTCCGAACTGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-3078s1c1
Sequence:CCGGGCACTGCAAATGTTTGTCTTTCTCGAGAAAGACAAACATTTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1041s1c1
Sequence:CCGGCGTTCACAGAACTCTGCATTTCTCGAGAAATGCAGAGTTCTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1374s1c1
Sequence:CCGGCCAACTTCTAATAGCTCCAAACTCGAGTTTGGAGCTATTAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-3201s1c1
Sequence:CCGGGCATTTGAACTCAAGCTACAACTCGAGTTGTAGCTTGAGTTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-2165s1c1
Sequence:CCGGGCTCCATTACAGCTTTGCATTCTCGAGAATGCAAAGCTGTAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1398s1c1
Sequence:CCGGGCTGAATTACACCGAATGGTACTCGAGTACCATTCGGTGTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-383s1c1
Sequence:CCGGGCAGTTACTGAAAGAACGGTTCTCGAGAACCGTTCTTTCAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017954.10-2455s21c1
Sequence:CCGGATGAGTACTGTGCCCGTTATGCTCGAGCATAACGGGCACAGTACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017954.10-3939s21c1
Sequence:CCGGGATCTGGCAGACACCTATATTCTCGAGAATATAGGTGTCTGCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017954
CADPS2 MISSION shRNA Lentiviral Transduction Particles
Ca++-dependent secretion activator 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-454s1c1
Sequence:CCGGGCAACGCAGTTCGGAGTTATTCTCGAGAATAACTCCGAACTGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-3078s1c1
Sequence:CCGGGCACTGCAAATGTTTGTCTTTCTCGAGAAAGACAAACATTTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1041s1c1
Sequence:CCGGCGTTCACAGAACTCTGCATTTCTCGAGAAATGCAGAGTTCTGTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1374s1c1
Sequence:CCGGCCAACTTCTAATAGCTCCAAACTCGAGTTTGGAGCTATTAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-3201s1c1
Sequence:CCGGGCATTTGAACTCAAGCTACAACTCGAGTTGTAGCTTGAGTTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-2165s1c1
Sequence:CCGGGCTCCATTACAGCTTTGCATTCTCGAGAATGCAAAGCTGTAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-1398s1c1
Sequence:CCGGGCTGAATTACACCGAATGGTACTCGAGTACCATTCGGTGTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017954.7-383s1c1
Sequence:CCGGGCAGTTACTGAAAGAACGGTTCTCGAGAACCGTTCTTTCAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017954.10-2455s21c1
Sequence:CCGGATGAGTACTGTGCCCGTTATGCTCGAGCATAACGGGCACAGTACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017954.10-3939s21c1
Sequence:CCGGGATCTGGCAGACACCTATATTCTCGAGAATATAGGTGTCTGCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153163
CADPS2 MISSION shRNA Bacterial Glycerol Stock
Ca++-dependent secretion activator 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153163.2-4161s1c1
Sequence:CCGGCCCATGACACAGCATTGTGAACTCGAGTTCACAATGCTGTGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-2055s1c1
Sequence:CCGGGCTCCATTACAGCTTTGCATTCTCGAGAATGCAAAGCTGTAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-802s1c1
Sequence:CCGGCCCAGATTCATCTCGAAAGAACTCGAGTTCTTTCGAGATGAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-2989s1c1
Sequence:CCGGGCGCTGCAAATGTTCGTCTTTCTCGAGAAAGACGAACATTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-1157s1c1
Sequence:CCGGCCCAAGGAGATTTCAACACTACTCGAGTAGTGTTGAAATCTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153163.3-4500s21c1
Sequence:CCGGTGGTGTGCCTCCCACTTATAACTCGAGTTATAAGTGGGAGGCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153163.3-3315s21c1
Sequence:CCGGTAATGGCCAGTGATATGATAGCTCGAGCTATCATATCACTGGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153163.3-1762s21c1
Sequence:CCGGGTCGGAACCACAGGAATTAATCTCGAGATTAATTCCTGTGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153163
CADPS2 MISSION shRNA shRNA Plasmid DNA
Ca++-dependent secretion activator 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153163.2-4161s1c1
Sequence:CCGGCCCATGACACAGCATTGTGAACTCGAGTTCACAATGCTGTGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-2055s1c1
Sequence:CCGGGCTCCATTACAGCTTTGCATTCTCGAGAATGCAAAGCTGTAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-802s1c1
Sequence:CCGGCCCAGATTCATCTCGAAAGAACTCGAGTTCTTTCGAGATGAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-2989s1c1
Sequence:CCGGGCGCTGCAAATGTTCGTCTTTCTCGAGAAAGACGAACATTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-1157s1c1
Sequence:CCGGCCCAAGGAGATTTCAACACTACTCGAGTAGTGTTGAAATCTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153163.3-4500s21c1
Sequence:CCGGTGGTGTGCCTCCCACTTATAACTCGAGTTATAAGTGGGAGGCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153163.3-3315s21c1
Sequence:CCGGTAATGGCCAGTGATATGATAGCTCGAGCTATCATATCACTGGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153163.3-1762s21c1
Sequence:CCGGGTCGGAACCACAGGAATTAATCTCGAGATTAATTCCTGTGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153163
CADPS2 MISSION shRNA Lentiviral Transduction Particles
Ca++-dependent secretion activator 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153163.2-4161s1c1
Sequence:CCGGCCCATGACACAGCATTGTGAACTCGAGTTCACAATGCTGTGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-2055s1c1
Sequence:CCGGGCTCCATTACAGCTTTGCATTCTCGAGAATGCAAAGCTGTAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-802s1c1
Sequence:CCGGCCCAGATTCATCTCGAAAGAACTCGAGTTCTTTCGAGATGAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-2989s1c1
Sequence:CCGGGCGCTGCAAATGTTCGTCTTTCTCGAGAAAGACGAACATTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153163.2-1157s1c1
Sequence:CCGGCCCAAGGAGATTTCAACACTACTCGAGTAGTGTTGAAATCTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153163.3-4500s21c1
Sequence:CCGGTGGTGTGCCTCCCACTTATAACTCGAGTTATAAGTGGGAGGCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153163.3-3315s21c1
Sequence:CCGGTAATGGCCAGTGATATGATAGCTCGAGCTATCATATCACTGGCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153163.3-1762s21c1
Sequence:CCGGGTCGGAACCACAGGAATTAATCTCGAGATTAATTCCTGTGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks