EMAIL THIS PAGE TO A FRIEND

CADPS

Ca++-dependent secretion activator

131 Gene Product Result for
Synonyms: CADPS1 CAPS CAPS1
Gene ID:
Human(8618) Summary: This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
Mouse(27062) Ca2+-dependent secretion activator
Rat(26989) Ca++-dependent secretion activator
chicken(416075) Ca++-dependent secretion activator
cow(534328) Ca++-dependent secretion activator
dog(484705) Ca++-dependent secretion activator
domestic cat(101086126) Ca++-dependent secretion activator
naked mole-rat(101707369) Ca++-dependent secretion activator
domestic guinea pig(100713441) Ca++-dependent secretion activator
sheep(101107141) Ca++-dependent secretion activator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003716 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003716 Rosetta Predictions human pricing
NM_183393 Rosetta Predictions human pricing
NM_183394 Rosetta Predictions human pricing
NM_013219 Rosetta Predictions rat pricing
NM_001042617 Rosetta Predictions mouse pricing
NM_012061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107310 predicted 1911
2 SASI_Hs01_00107311 predicted 4174
3 SASI_Hs01_00107312 predicted 4208
4 SASI_Hs01_00107313 predicted 1283
5 SASI_Hs01_00107314 predicted 4283
6 SASI_Hs01_00107315 predicted 1570
7 SASI_Hs01_00107316 predicted 3885
8 SASI_Hs01_00107317 predicted 4440
9 SASI_Hs01_00107318 predicted 1918
10 SASI_Hs02_00336143 predicted 4232
11 SASI_Hs01_00107319 predicted 4281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030693 predicted 1908
2 SASI_Hs01_00030694 predicted 3939
3 SASI_Hs01_00030695 predicted 3969
4 SASI_Hs01_00030696 predicted 1285
5 SASI_Hs01_00030697 predicted 4044
6 SASI_Hs01_00030698 predicted 1570
7 SASI_Hs01_00030699 predicted 3650
8 SASI_Hs01_00030700 predicted 4207
9 SASI_Hs01_00030701 predicted 1925
10 SASI_Hs02_00371298 predicted 3998
11 SASI_Hs01_00030702 predicted 4044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083680 predicted 1914
2 SASI_Hs01_00083681 predicted 4056
3 SASI_Hs01_00083682 predicted 4090
4 SASI_Hs01_00083683 predicted 1289
5 SASI_Hs01_00083684 predicted 4172
6 SASI_Hs01_00083685 predicted 1569
7 SASI_Hs01_00083686 predicted 3768
8 SASI_Hs01_00083687 predicted 4331
9 SASI_Hs01_00083688 predicted 1922
10 SASI_Hs02_00371299 predicted 4123
11 SASI_Hs01_00083689 predicted 4154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111072 predicted 1166
2 SASI_Rn01_00111073 predicted 3726
3 SASI_Rn01_00111074 predicted 2644
4 SASI_Rn01_00111075 predicted 1419
5 SASI_Rn02_00261082 predicted 862
6 SASI_Rn01_00111076 predicted 3132
7 SASI_Rn01_00111077 predicted 2124
8 SASI_Rn01_00111078 predicted 3635
9 SASI_Rn01_00111079 predicted 2965
10 SASI_Rn02_00261083 predicted 3266
11 SASI_Rn01_00111071 predicted 3987
12 SASI_Rn01_00111080 predicted 3761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290765 predicted 4207
2 SASI_Mm02_00290766 predicted 4353
3 SASI_Mm02_00290767 predicted 3848
4 SASI_Mm02_00290768 predicted 1151
5 SASI_Mm02_00290769 predicted 3507
6 SASI_Mm02_00290770 predicted 4112
7 SASI_Mm02_00290771 predicted 3613
8 SASI_Mm02_00290772 predicted 3735
9 SASI_Mm02_00290773 predicted 4449
10 SASI_Mm02_00290774 predicted 4121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322042 predicted 4227
2 SASI_Mm02_00322043 predicted 4364
3 SASI_Mm01_00096254 predicted 3862
4 SASI_Mm01_00096255 predicted 1151
5 SASI_Mm01_00096256 predicted 3528
6 SASI_Mm01_00096258 predicted 4131
7 SASI_Mm01_00096259 predicted 3629
8 SASI_Mm01_00096260 predicted 3760
9 SASI_Mm02_00322044 predicted 4461
10 SASI_Mm01_00096261 predicted 4145
11 SASI_Mm01_00096252 predicted 2978
12 SASI_Mm01_00096253 predicted 3203
13 SASI_Mm01_00096257 predicted 2942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012061
CADPS MISSION shRNA Bacterial Glycerol Stock
Ca++-dependent secretion activator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-3809s1c1
Sequence:CCGGGCCAAGAGCATCAATACCATTCTCGAGAATGGTATTGATGCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-1261s1c1
Sequence:CCGGGCAGATCAAATAGCCAGGGAACTCGAGTTCCCTGGCTATTTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-2863s1c1
Sequence:CCGGCGCCTATCTGAGTATGCCAAACTCGAGTTTGGCATACTCAGATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012061.2-4614s1c1
Sequence:CCGGCCATTCTTAAACACTGTTCATCTCGAGATGAACAGTGTTTAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-2327s1c1
Sequence:CCGGCCTGTAACTTTGACCACGCTTCTCGAGAAGCGTGGTCAAAGTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012061
CADPS MISSION shRNA shRNA Plasmid DNA
Ca++-dependent secretion activator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-3809s1c1
Sequence:CCGGGCCAAGAGCATCAATACCATTCTCGAGAATGGTATTGATGCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-1261s1c1
Sequence:CCGGGCAGATCAAATAGCCAGGGAACTCGAGTTCCCTGGCTATTTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-2863s1c1
Sequence:CCGGCGCCTATCTGAGTATGCCAAACTCGAGTTTGGCATACTCAGATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012061.2-4614s1c1
Sequence:CCGGCCATTCTTAAACACTGTTCATCTCGAGATGAACAGTGTTTAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-2327s1c1
Sequence:CCGGCCTGTAACTTTGACCACGCTTCTCGAGAAGCGTGGTCAAAGTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012061
CADPS MISSION shRNA Lentiviral Transduction Particles
Ca++-dependent secretion activator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-3809s1c1
Sequence:CCGGGCCAAGAGCATCAATACCATTCTCGAGAATGGTATTGATGCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-1261s1c1
Sequence:CCGGGCAGATCAAATAGCCAGGGAACTCGAGTTCCCTGGCTATTTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-2863s1c1
Sequence:CCGGCGCCTATCTGAGTATGCCAAACTCGAGTTTGGCATACTCAGATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012061.2-4614s1c1
Sequence:CCGGCCATTCTTAAACACTGTTCATCTCGAGATGAACAGTGTTTAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012061.2-2327s1c1
Sequence:CCGGCCTGTAACTTTGACCACGCTTCTCGAGAAGCGTGGTCAAAGTTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003716
CADPS MISSION shRNA Bacterial Glycerol Stock
Ca++-dependent secretion activator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-4176s1c1
Sequence:CCGGCGGATGGACTTACAGCTTCATCTCGAGATGAAGCTGTAAGTCCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-2790s1c1
Sequence:CCGGCTCTCACTCTTGGAAAGGGTTCTCGAGAACCCTTTCCAAGAGTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-3396s1c1
Sequence:CCGGCCCAATGTGAACCTACCCAATCTCGAGATTGGGTAGGTTCACATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-3507s1c1
Sequence:CCGGGCTATATATGATGCGGATAATCTCGAGATTATCCGCATCATATATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003716.2-4715s1c1
Sequence:CCGGGCTTCATTCATGTACTATGTACTCGAGTACATAGTACATGAATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-2341s1c1
Sequence:CCGGGCATGGATGAATTTATCTCTTCTCGAGAAGAGATAAATTCATCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-3876s1c1
Sequence:CCGGGAAATGATAACACTCTTGGTTCTCGAGAACCAAGAGTGTTATCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003716.2-4512s1c1
Sequence:CCGGGCCCATGAGATGTTTATCAATCTCGAGATTGATAAACATCTCATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-890s1c1
Sequence:CCGGGCAGAGTTACTATGAGGTGTTCTCGAGAACACCTCATAGTAACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-2961s1c1
Sequence:CCGGCGGTTAATCACTCCTGCCAAACTCGAGTTTGGCAGGAGTGATTAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003716
CADPS MISSION shRNA shRNA Plasmid DNA
Ca++-dependent secretion activator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-4176s1c1
Sequence:CCGGCGGATGGACTTACAGCTTCATCTCGAGATGAAGCTGTAAGTCCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-2790s1c1
Sequence:CCGGCTCTCACTCTTGGAAAGGGTTCTCGAGAACCCTTTCCAAGAGTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-3396s1c1
Sequence:CCGGCCCAATGTGAACCTACCCAATCTCGAGATTGGGTAGGTTCACATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-3507s1c1
Sequence:CCGGGCTATATATGATGCGGATAATCTCGAGATTATCCGCATCATATATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003716.2-4715s1c1
Sequence:CCGGGCTTCATTCATGTACTATGTACTCGAGTACATAGTACATGAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-2341s1c1
Sequence:CCGGGCATGGATGAATTTATCTCTTCTCGAGAAGAGATAAATTCATCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-3876s1c1
Sequence:CCGGGAAATGATAACACTCTTGGTTCTCGAGAACCAAGAGTGTTATCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003716.2-4512s1c1
Sequence:CCGGGCCCATGAGATGTTTATCAATCTCGAGATTGATAAACATCTCATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-890s1c1
Sequence:CCGGGCAGAGTTACTATGAGGTGTTCTCGAGAACACCTCATAGTAACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-2961s1c1
Sequence:CCGGCGGTTAATCACTCCTGCCAAACTCGAGTTTGGCAGGAGTGATTAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003716
CADPS MISSION shRNA Lentiviral Transduction Particles
Ca++-dependent secretion activator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-4176s1c1
Sequence:CCGGCGGATGGACTTACAGCTTCATCTCGAGATGAAGCTGTAAGTCCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-2790s1c1
Sequence:CCGGCTCTCACTCTTGGAAAGGGTTCTCGAGAACCCTTTCCAAGAGTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-3396s1c1
Sequence:CCGGCCCAATGTGAACCTACCCAATCTCGAGATTGGGTAGGTTCACATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-3507s1c1
Sequence:CCGGGCTATATATGATGCGGATAATCTCGAGATTATCCGCATCATATATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003716.2-4715s1c1
Sequence:CCGGGCTTCATTCATGTACTATGTACTCGAGTACATAGTACATGAATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-2341s1c1
Sequence:CCGGGCATGGATGAATTTATCTCTTCTCGAGAAGAGATAAATTCATCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003716.2-3876s1c1
Sequence:CCGGGAAATGATAACACTCTTGGTTCTCGAGAACCAAGAGTGTTATCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003716.2-4512s1c1
Sequence:CCGGGCCCATGAGATGTTTATCAATCTCGAGATTGATAAACATCTCATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-890s1c1
Sequence:CCGGGCAGAGTTACTATGAGGTGTTCTCGAGAACACCTCATAGTAACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003716.2-2961s1c1
Sequence:CCGGCGGTTAATCACTCCTGCCAAACTCGAGTTTGGCAGGAGTGATTAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)