EMAIL THIS PAGE TO A FRIEND

CAGE1

cancer antigen 1

72 Gene Product Result for
Synonyms: CT3 CT95 CTAG3 bA69L16.7
UniProtKB ID: Q8TC20, D6RCT9, Q5TAM0, Q86TM4, Q8N7R5
Gene ID:
Mouse(71213) cancer antigen 1
Rat(306872) cancer antigen 1
domestic cat(101101467) cancer antigen 1
Horse(100061413) cancer antigen 1
cow(527833) cancer antigen 1
dog(609230) cancer antigen 1
naked mole-rat(101717640) cancer antigen 1
sheep(101119428) cancer antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175745 Rosetta Predictions human pricing
NM_205864 Rosetta Predictions human pricing
NM_001012052 Rosetta Predictions rat pricing
XM_574006 Rosetta Predictions rat pricing
NM_027724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162706 predicted 1366
2 SASI_Hs01_00162707 predicted 1437
3 SASI_Hs01_00162708 predicted 1671
4 SASI_Hs01_00162709 predicted 752
5 SASI_Hs01_00162710 predicted 787
6 SASI_Hs01_00162711 predicted 1922
7 SASI_Hs01_00162712 predicted 1754
8 SASI_Hs01_00162713 predicted 1297
9 SASI_Hs01_00162714 predicted 1223
10 SASI_Hs01_00162715 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198419 predicted 1448
2 SASI_Hs02_00373511 predicted 2394
3 SASI_Hs02_00373512 predicted 1452
4 SASI_Hs01_00198422 predicted 835
5 SASI_Hs01_00198423 predicted 872
6 SASI_Hs01_00198424 predicted 2003
7 SASI_Hs01_00198425 predicted 1837
8 SASI_Hs01_00198426 predicted 1376
9 SASI_Hs02_00373513 predicted 2326
10 SASI_Hs01_00198427 predicted 1300
11 SASI_Hs01_00198420 predicted 1518
12 SASI_Hs01_00198421 predicted 1757
13 SASI_Hs01_00198428 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047533 predicted 1747
2 SASI_Rn01_00047534 predicted 883
3 SASI_Rn01_00047535 predicted 1568
4 SASI_Rn01_00047536 predicted 2340
5 SASI_Rn01_00047537 predicted 544
6 SASI_Rn01_00047538 predicted 2601
7 SASI_Rn01_00047539 predicted 2601
8 SASI_Rn01_00047540 predicted 2632
9 SASI_Rn01_00047541 predicted 2140
10 SASI_Rn02_00200158 predicted 408
11 SASI_Rn01_00047542 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126410 predicted 884
2 SASI_Rn01_00126411 predicted 449
3 SASI_Rn01_00126412 predicted 954
4 SASI_Rn01_00126413 predicted 2347
5 SASI_Rn01_00126414 predicted 550
6 SASI_Rn01_00126415 predicted 2605
7 SASI_Rn01_00126416 predicted 2611
8 SASI_Rn01_00126417 predicted 2634
9 SASI_Rn01_00126418 predicted 555
10 SASI_Rn01_00126419 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332652 predicted 1112
2 SASI_Mm01_00168460 predicted 820
3 SASI_Mm01_00168461 predicted 1801
4 SASI_Mm01_00168463 predicted 2201
5 SASI_Mm01_00168464 predicted 1464
6 SASI_Mm01_00168465 predicted 2088
7 SASI_Mm01_00168466 predicted 448
8 SASI_Mm01_00168467 predicted 236
9 SASI_Mm01_00168468 predicted 476
10 SASI_Mm02_00332653 predicted 316
11 SASI_Mm01_00168459 predicted 509
12 SASI_Mm01_00168462 predicted 1323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027724
CAGE1 MISSION shRNA Bacterial Glycerol Stock
cancer antigen 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1107s21c1
Sequence:CCGGGGTGAACATTGAGGAGTTAATCTCGAGATTAACTCCTCAATGTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1076s21c1
Sequence:CCGGACGTGTTGGTTGATATCATAACTCGAGTTATGATATCAACCAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-1077s1c1
Sequence:CCGGCGTGTTGGTTGATATCATAAACTCGAGTTTATGATATCAACCAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-298s1c1
Sequence:CCGGCACTGGATAGAAGCGTTTAACCTCGAGGTTAAACGCTTCTATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-2062s21c1
Sequence:CCGGGCGACTCTTAAAGAGTTAATTCTCGAGAATTAACTCTTTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1287s21c1
Sequence:CCGGGCGCTTACAGGAAAGGTATATCTCGAGATATACCTTTCCTGTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-298s21c1
Sequence:CCGGCACTGGATAGAAGCGTTTAACCTCGAGGTTAAACGCTTCTATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-2315s1c1
Sequence:CCGGGCAGCCTGATAAATAAGGTAACTCGAGTTACCTTATTTATCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-1540s1c1
Sequence:CCGGCGGAAATTGAAGTCGAGAGTTCTCGAGAACTCTCGACTTCAATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-421s1c1
Sequence:CCGGCCAGATCCATTTAAGGAAGAACTCGAGTTCTTCCTTAAATGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027724
CAGE1 MISSION shRNA shRNA Plasmid DNA
cancer antigen 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1107s21c1
Sequence:CCGGGGTGAACATTGAGGAGTTAATCTCGAGATTAACTCCTCAATGTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1076s21c1
Sequence:CCGGACGTGTTGGTTGATATCATAACTCGAGTTATGATATCAACCAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-1077s1c1
Sequence:CCGGCGTGTTGGTTGATATCATAAACTCGAGTTTATGATATCAACCAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-298s1c1
Sequence:CCGGCACTGGATAGAAGCGTTTAACCTCGAGGTTAAACGCTTCTATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-2062s21c1
Sequence:CCGGGCGACTCTTAAAGAGTTAATTCTCGAGAATTAACTCTTTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1287s21c1
Sequence:CCGGGCGCTTACAGGAAAGGTATATCTCGAGATATACCTTTCCTGTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-298s21c1
Sequence:CCGGCACTGGATAGAAGCGTTTAACCTCGAGGTTAAACGCTTCTATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-2315s1c1
Sequence:CCGGGCAGCCTGATAAATAAGGTAACTCGAGTTACCTTATTTATCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-1540s1c1
Sequence:CCGGCGGAAATTGAAGTCGAGAGTTCTCGAGAACTCTCGACTTCAATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-421s1c1
Sequence:CCGGCCAGATCCATTTAAGGAAGAACTCGAGTTCTTCCTTAAATGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027724
CAGE1 MISSION shRNA Lentiviral Transduction Particles
cancer antigen 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1107s21c1
Sequence:CCGGGGTGAACATTGAGGAGTTAATCTCGAGATTAACTCCTCAATGTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1076s21c1
Sequence:CCGGACGTGTTGGTTGATATCATAACTCGAGTTATGATATCAACCAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-1077s1c1
Sequence:CCGGCGTGTTGGTTGATATCATAAACTCGAGTTTATGATATCAACCAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-298s1c1
Sequence:CCGGCACTGGATAGAAGCGTTTAACCTCGAGGTTAAACGCTTCTATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-2062s21c1
Sequence:CCGGGCGACTCTTAAAGAGTTAATTCTCGAGAATTAACTCTTTAAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-1287s21c1
Sequence:CCGGGCGCTTACAGGAAAGGTATATCTCGAGATATACCTTTCCTGTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027724.1-298s21c1
Sequence:CCGGCACTGGATAGAAGCGTTTAACCTCGAGGTTAAACGCTTCTATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-2315s1c1
Sequence:CCGGGCAGCCTGATAAATAAGGTAACTCGAGTTACCTTATTTATCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-1540s1c1
Sequence:CCGGCGGAAATTGAAGTCGAGAGTTCTCGAGAACTCTCGACTTCAATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027724.1-421s1c1
Sequence:CCGGCCAGATCCATTTAAGGAAGAACTCGAGTTCTTCCTTAAATGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175745
CAGE1 MISSION shRNA Bacterial Glycerol Stock
cancer antigen 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-2267s1c1
Sequence:CCGGGAGAGTTAATTGCTAAGGAAACTCGAGTTTCCTTAGCAATTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-418s1c1
Sequence:CCGGCCTCAGAACGAAATAAAGAATCTCGAGATTCTTTATTTCGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175745.3-2808s1c1
Sequence:CCGGGCCTGAAGATTAAACAGTAATCTCGAGATTACTGTTTAATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-961s1c1
Sequence:CCGGGAGATGTCAGTCAGTTATGAACTCGAGTTCATAACTGACTGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175745.3-2393s1c1
Sequence:CCGGGCCAAGAGTATCAGAGATGTACTCGAGTACATCTCTGATACTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175745
CAGE1 MISSION shRNA shRNA Plasmid DNA
cancer antigen 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-2267s1c1
Sequence:CCGGGAGAGTTAATTGCTAAGGAAACTCGAGTTTCCTTAGCAATTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-418s1c1
Sequence:CCGGCCTCAGAACGAAATAAAGAATCTCGAGATTCTTTATTTCGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175745.3-2808s1c1
Sequence:CCGGGCCTGAAGATTAAACAGTAATCTCGAGATTACTGTTTAATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-961s1c1
Sequence:CCGGGAGATGTCAGTCAGTTATGAACTCGAGTTCATAACTGACTGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175745.3-2393s1c1
Sequence:CCGGGCCAAGAGTATCAGAGATGTACTCGAGTACATCTCTGATACTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175745
CAGE1 MISSION shRNA Lentiviral Transduction Particles
cancer antigen 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-2267s1c1
Sequence:CCGGGAGAGTTAATTGCTAAGGAAACTCGAGTTTCCTTAGCAATTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-418s1c1
Sequence:CCGGCCTCAGAACGAAATAAAGAATCTCGAGATTCTTTATTTCGTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175745.3-2808s1c1
Sequence:CCGGGCCTGAAGATTAAACAGTAATCTCGAGATTACTGTTTAATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175745.3-961s1c1
Sequence:CCGGGAGATGTCAGTCAGTTATGAACTCGAGTTCATAACTGACTGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175745.3-2393s1c1
Sequence:CCGGGCCAAGAGTATCAGAGATGTACTCGAGTACATCTCTGATACTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks