EMAIL THIS PAGE TO A FRIEND

CALB1

calbindin 1, 28kDa

170 Gene Product Result for
Synonyms: CALB
UniProtKB ID: P05937, B2R696
Gene ID:
Human(793) Summary: Calbindin is a calcium-binding protein belonging to the troponin C superfamily. It was originally described as a 27-kD protein induced by vitamin D in the duodenum of the chick. In the brain, its synthesis is independent of vitamin-D-derived hormones. Calbindin contains 4 active calcium-binding domains, and 2 modified domains that presumably have lost their calcium-binding capacity. The neurons in brains of patients with Huntington disease are calbindin-depleted. [provided by RefSeq, Jul 2008]
Mouse(12307) calbindin 1
Rat(83839) calbindin 1
Zebrafish(100001650) calbindin 1
chicken(396519) calbindin 1, 28kDa
dog(611334) calbindin 1, 28kDa
domestic cat(101100617) calbindin 1, 28kDa
cow(539930) calbindin 1, 28kDa
Horse(100034057) calbindin 1, 28kDa
naked mole-rat(101721433) calbindin 1, 28kDa
domestic guinea pig(100732072) calbindin 1, 28kDa
sheep(101114786) calbindin 1, 28kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0632 Human CALB1 / Calbindin ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004929 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004929 Rosetta Predictions human pricing
NM_031984 Rosetta Predictions rat pricing
NM_009788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014030 predicted 329
2 SASI_Hs02_00338594 predicted 826
3 SASI_Hs01_00014031 predicted 853
4 SASI_Hs01_00014032 predicted 330
5 SASI_Hs01_00014033 predicted 235
6 SASI_Hs01_00014035 predicted 236
7 SASI_Hs01_00014036 predicted 578
8 SASI_Hs01_00014038 predicted 988
9 SASI_Hs01_00014039 predicted 706
10 SASI_Hs02_00338595 predicted 887
11 SASI_Hs01_00014034 predicted 741
12 SASI_Hs01_00014037 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064492 predicted 785
2 SASI_Rn01_00064493 predicted 612
3 SASI_Rn01_00064494 predicted 530
4 SASI_Rn01_00064495 predicted 755
5 SASI_Rn01_00064496 predicted 955
6 SASI_Rn01_00064497 predicted 372
7 SASI_Rn01_00064498 predicted 265
8 SASI_Rn01_00064499 predicted 676
9 SASI_Rn01_00064500 predicted 853
10 SASI_Rn01_00064501 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077598 predicted 801
2 SASI_Mm01_00077599 predicted 632
3 SASI_Mm02_00317030 predicted 660
4 SASI_Mm01_00077600 predicted 314
5 SASI_Mm01_00077601 predicted 531
6 SASI_Mm02_00317031 predicted 414
7 SASI_Mm01_00077602 predicted 285
8 SASI_Mm01_00077603 predicted 347
9 SASI_Mm01_00077604 predicted 966
10 SASI_Mm01_00077605 predicted 577
11 SASI_Mm01_00077606 predicted 705
12 SASI_Mm01_00077607 predicted 978
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009788
CALB1 MISSION shRNA Bacterial Glycerol Stock
calbindin 1, 28kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-288s1c1
Sequence:CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-581s1c1
Sequence:CCGGCTCATGCTGAAACTATTTGATCTCGAGATCAAATAGTTTCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-741s1c1
Sequence:CCGGGCAACGGATACATAGATGAAACTCGAGTTTCATCTATGTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009788.2-2635s1c1
Sequence:CCGGGCCAACAATAAATCCTAGAATCTCGAGATTCTAGGATTTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-578s1c1
Sequence:CCGGGACCTCATGCTGAAACTATTTCTCGAGAAATAGTTTCAGCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009788
CALB1 MISSION shRNA shRNA Plasmid DNA
calbindin 1, 28kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-288s1c1
Sequence:CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-581s1c1
Sequence:CCGGCTCATGCTGAAACTATTTGATCTCGAGATCAAATAGTTTCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-741s1c1
Sequence:CCGGGCAACGGATACATAGATGAAACTCGAGTTTCATCTATGTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009788.2-2635s1c1
Sequence:CCGGGCCAACAATAAATCCTAGAATCTCGAGATTCTAGGATTTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-578s1c1
Sequence:CCGGGACCTCATGCTGAAACTATTTCTCGAGAAATAGTTTCAGCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009788
CALB1 MISSION shRNA Lentiviral Transduction Particles
calbindin 1, 28kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-288s1c1
Sequence:CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-581s1c1
Sequence:CCGGCTCATGCTGAAACTATTTGATCTCGAGATCAAATAGTTTCAGCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-741s1c1
Sequence:CCGGGCAACGGATACATAGATGAAACTCGAGTTTCATCTATGTATCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009788.2-2635s1c1
Sequence:CCGGGCCAACAATAAATCCTAGAATCTCGAGATTCTAGGATTTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009788.2-578s1c1
Sequence:CCGGGACCTCATGCTGAAACTATTTCTCGAGAAATAGTTTCAGCATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004929
CALB1 MISSION shRNA Bacterial Glycerol Stock
calbindin 1, 28kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-927s1c1
Sequence:CCGGCGAACGGATCTTGCTCTTATTCTCGAGAATAAGAGCAAGATCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-622s1c1
Sequence:CCGGCAGACCTAATGCTGAAACTATCTCGAGATAGTTTCAGCATTAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-334s1c1
Sequence:CCGGGATTGGAGTTATCACCTGAAACTCGAGTTTCAGGTGATAACTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-713s1c1
Sequence:CCGGTCTTCTTAAATTCCAGGGAATCTCGAGATTCCCTGGAATTTAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-787s1c1
Sequence:CCGGGCAATGGATACATAGATGAAACTCGAGTTTCATCTATGTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004929.2-992s21c1
Sequence:CCGGTAGTGATACACTGTATCTAAACTCGAGTTTAGATACAGTGTATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004929.2-848s21c1
Sequence:CCGGTAAACAGGATCTGGATATTAACTCGAGTTAATATCCAGATCCTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004929.2-656s21c1
Sequence:CCGGTGATGGGAAGCTGGAATTAACCTCGAGGTTAATTCCAGCTTCCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004929
CALB1 MISSION shRNA shRNA Plasmid DNA
calbindin 1, 28kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-927s1c1
Sequence:CCGGCGAACGGATCTTGCTCTTATTCTCGAGAATAAGAGCAAGATCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-622s1c1
Sequence:CCGGCAGACCTAATGCTGAAACTATCTCGAGATAGTTTCAGCATTAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-334s1c1
Sequence:CCGGGATTGGAGTTATCACCTGAAACTCGAGTTTCAGGTGATAACTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-713s1c1
Sequence:CCGGTCTTCTTAAATTCCAGGGAATCTCGAGATTCCCTGGAATTTAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-787s1c1
Sequence:CCGGGCAATGGATACATAGATGAAACTCGAGTTTCATCTATGTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004929.2-992s21c1
Sequence:CCGGTAGTGATACACTGTATCTAAACTCGAGTTTAGATACAGTGTATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004929.2-848s21c1
Sequence:CCGGTAAACAGGATCTGGATATTAACTCGAGTTAATATCCAGATCCTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004929.2-656s21c1
Sequence:CCGGTGATGGGAAGCTGGAATTAACCTCGAGGTTAATTCCAGCTTCCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004929
CALB1 MISSION shRNA Lentiviral Transduction Particles
calbindin 1, 28kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-927s1c1
Sequence:CCGGCGAACGGATCTTGCTCTTATTCTCGAGAATAAGAGCAAGATCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-622s1c1
Sequence:CCGGCAGACCTAATGCTGAAACTATCTCGAGATAGTTTCAGCATTAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-334s1c1
Sequence:CCGGGATTGGAGTTATCACCTGAAACTCGAGTTTCAGGTGATAACTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-713s1c1
Sequence:CCGGTCTTCTTAAATTCCAGGGAATCTCGAGATTCCCTGGAATTTAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004929.2-787s1c1
Sequence:CCGGGCAATGGATACATAGATGAAACTCGAGTTTCATCTATGTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004929.2-992s21c1
Sequence:CCGGTAGTGATACACTGTATCTAAACTCGAGTTTAGATACAGTGTATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004929.2-848s21c1
Sequence:CCGGTAAACAGGATCTGGATATTAACTCGAGTTAATATCCAGATCCTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004929.2-656s21c1
Sequence:CCGGTGATGGGAAGCTGGAATTAACCTCGAGGTTAATTCCAGCTTCCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks